ID: 1002887884

View in Genome Browser
Species Human (GRCh38)
Location 6:1312229-1312251
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002887884_1002887890 13 Left 1002887884 6:1312229-1312251 CCACGGTGGCACGCACATCATCC No data
Right 1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
1002887884_1002887895 20 Left 1002887884 6:1312229-1312251 CCACGGTGGCACGCACATCATCC No data
Right 1002887895 6:1312272-1312294 AAGACGCCCGCGCGGGACCTGGG 0: 1
1: 0
2: 0
3: 0
4: 36
1002887884_1002887894 19 Left 1002887884 6:1312229-1312251 CCACGGTGGCACGCACATCATCC No data
Right 1002887894 6:1312271-1312293 GAAGACGCCCGCGCGGGACCTGG 0: 1
1: 0
2: 1
3: 3
4: 87
1002887884_1002887889 12 Left 1002887884 6:1312229-1312251 CCACGGTGGCACGCACATCATCC No data
Right 1002887889 6:1312264-1312286 GTGCCCCGAAGACGCCCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002887884 Original CRISPR GGATGATGTGCGTGCCACCG TGG (reversed) Intergenic