ID: 1002887885 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:1312231-1312253 |
Sequence | ACGGTGGCACGCACATCATC CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1002887879_1002887885 | -9 | Left | 1002887879 | 6:1312217-1312239 | CCGGACCTTCCCCCACGGTGGCA | No data | ||
Right | 1002887885 | 6:1312231-1312253 | ACGGTGGCACGCACATCATCCGG | No data | ||||
1002887874_1002887885 | 16 | Left | 1002887874 | 6:1312192-1312214 | CCGCGGGTGCTCAAGGCTGAAGG | No data | ||
Right | 1002887885 | 6:1312231-1312253 | ACGGTGGCACGCACATCATCCGG | No data | ||||
1002887873_1002887885 | 19 | Left | 1002887873 | 6:1312189-1312211 | CCTCCGCGGGTGCTCAAGGCTGA | No data | ||
Right | 1002887885 | 6:1312231-1312253 | ACGGTGGCACGCACATCATCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1002887885 | Original CRISPR | ACGGTGGCACGCACATCATC CGG | Intergenic | ||