ID: 1002887885

View in Genome Browser
Species Human (GRCh38)
Location 6:1312231-1312253
Sequence ACGGTGGCACGCACATCATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002887879_1002887885 -9 Left 1002887879 6:1312217-1312239 CCGGACCTTCCCCCACGGTGGCA No data
Right 1002887885 6:1312231-1312253 ACGGTGGCACGCACATCATCCGG No data
1002887873_1002887885 19 Left 1002887873 6:1312189-1312211 CCTCCGCGGGTGCTCAAGGCTGA No data
Right 1002887885 6:1312231-1312253 ACGGTGGCACGCACATCATCCGG No data
1002887874_1002887885 16 Left 1002887874 6:1312192-1312214 CCGCGGGTGCTCAAGGCTGAAGG No data
Right 1002887885 6:1312231-1312253 ACGGTGGCACGCACATCATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002887885 Original CRISPR ACGGTGGCACGCACATCATC CGG Intergenic