ID: 1002887886

View in Genome Browser
Species Human (GRCh38)
Location 6:1312250-1312272
Sequence TCGGGGCACGGAAATGGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002887886_1002887900 24 Left 1002887886 6:1312250-1312272 CCGGCACCATTTCCGTGCCCCGA No data
Right 1002887900 6:1312297-1312319 CGCCAGTGAAGAACCCCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 58
1002887886_1002887895 -1 Left 1002887886 6:1312250-1312272 CCGGCACCATTTCCGTGCCCCGA No data
Right 1002887895 6:1312272-1312294 AAGACGCCCGCGCGGGACCTGGG 0: 1
1: 0
2: 0
3: 0
4: 36
1002887886_1002887901 25 Left 1002887886 6:1312250-1312272 CCGGCACCATTTCCGTGCCCCGA No data
Right 1002887901 6:1312298-1312320 GCCAGTGAAGAACCCCTCCTGGG 0: 1
1: 0
2: 3
3: 11
4: 127
1002887886_1002887890 -8 Left 1002887886 6:1312250-1312272 CCGGCACCATTTCCGTGCCCCGA No data
Right 1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
1002887886_1002887894 -2 Left 1002887886 6:1312250-1312272 CCGGCACCATTTCCGTGCCCCGA No data
Right 1002887894 6:1312271-1312293 GAAGACGCCCGCGCGGGACCTGG 0: 1
1: 0
2: 1
3: 3
4: 87
1002887886_1002887889 -9 Left 1002887886 6:1312250-1312272 CCGGCACCATTTCCGTGCCCCGA No data
Right 1002887889 6:1312264-1312286 GTGCCCCGAAGACGCCCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002887886 Original CRISPR TCGGGGCACGGAAATGGTGC CGG (reversed) Intergenic
No off target data available for this crispr