ID: 1002887887

View in Genome Browser
Species Human (GRCh38)
Location 6:1312256-1312278
Sequence GCGTCTTCGGGGCACGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002887887_1002887901 19 Left 1002887887 6:1312256-1312278 CCATTTCCGTGCCCCGAAGACGC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1002887901 6:1312298-1312320 GCCAGTGAAGAACCCCTCCTGGG 0: 1
1: 0
2: 3
3: 11
4: 127
1002887887_1002887894 -8 Left 1002887887 6:1312256-1312278 CCATTTCCGTGCCCCGAAGACGC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1002887894 6:1312271-1312293 GAAGACGCCCGCGCGGGACCTGG 0: 1
1: 0
2: 1
3: 3
4: 87
1002887887_1002887900 18 Left 1002887887 6:1312256-1312278 CCATTTCCGTGCCCCGAAGACGC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1002887900 6:1312297-1312319 CGCCAGTGAAGAACCCCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 58
1002887887_1002887895 -7 Left 1002887887 6:1312256-1312278 CCATTTCCGTGCCCCGAAGACGC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1002887895 6:1312272-1312294 AAGACGCCCGCGCGGGACCTGGG 0: 1
1: 0
2: 0
3: 0
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002887887 Original CRISPR GCGTCTTCGGGGCACGGAAA TGG (reversed) Intergenic