ID: 1002887888 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:1312262-1312284 |
Sequence | GCGCGGGCGTCTTCGGGGCA CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 78 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 68} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1002887888_1002887901 | 13 | Left | 1002887888 | 6:1312262-1312284 | CCGTGCCCCGAAGACGCCCGCGC | 0: 1 1: 0 2: 0 3: 9 4: 68 |
||
Right | 1002887901 | 6:1312298-1312320 | GCCAGTGAAGAACCCCTCCTGGG | 0: 1 1: 0 2: 3 3: 11 4: 127 |
||||
1002887888_1002887900 | 12 | Left | 1002887888 | 6:1312262-1312284 | CCGTGCCCCGAAGACGCCCGCGC | 0: 1 1: 0 2: 0 3: 9 4: 68 |
||
Right | 1002887900 | 6:1312297-1312319 | CGCCAGTGAAGAACCCCTCCTGG | 0: 1 1: 0 2: 0 3: 7 4: 58 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1002887888 | Original CRISPR | GCGCGGGCGTCTTCGGGGCA CGG (reversed) | Intergenic | ||