ID: 1002887889

View in Genome Browser
Species Human (GRCh38)
Location 6:1312264-1312286
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 34}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002887880_1002887889 19 Left 1002887880 6:1312222-1312244 CCTTCCCCCACGGTGGCACGCAC No data
Right 1002887889 6:1312264-1312286 GTGCCCCGAAGACGCCCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 34
1002887881_1002887889 15 Left 1002887881 6:1312226-1312248 CCCCCACGGTGGCACGCACATCA No data
Right 1002887889 6:1312264-1312286 GTGCCCCGAAGACGCCCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 34
1002887883_1002887889 13 Left 1002887883 6:1312228-1312250 CCCACGGTGGCACGCACATCATC No data
Right 1002887889 6:1312264-1312286 GTGCCCCGAAGACGCCCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 34
1002887882_1002887889 14 Left 1002887882 6:1312227-1312249 CCCCACGGTGGCACGCACATCAT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1002887889 6:1312264-1312286 GTGCCCCGAAGACGCCCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 34
1002887886_1002887889 -9 Left 1002887886 6:1312250-1312272 CCGGCACCATTTCCGTGCCCCGA No data
Right 1002887889 6:1312264-1312286 GTGCCCCGAAGACGCCCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 34
1002887884_1002887889 12 Left 1002887884 6:1312229-1312251 CCACGGTGGCACGCACATCATCC No data
Right 1002887889 6:1312264-1312286 GTGCCCCGAAGACGCCCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 34
1002887879_1002887889 24 Left 1002887879 6:1312217-1312239 CCGGACCTTCCCCCACGGTGGCA No data
Right 1002887889 6:1312264-1312286 GTGCCCCGAAGACGCCCGCGCGG 0: 1
1: 0
2: 1
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002887889 Original CRISPR GTGCCCCGAAGACGCCCGCG CGG Intergenic