ID: 1002887890

View in Genome Browser
Species Human (GRCh38)
Location 6:1312265-1312287
Sequence TGCCCCGAAGACGCCCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 42}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002887881_1002887890 16 Left 1002887881 6:1312226-1312248 CCCCCACGGTGGCACGCACATCA No data
Right 1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
1002887886_1002887890 -8 Left 1002887886 6:1312250-1312272 CCGGCACCATTTCCGTGCCCCGA No data
Right 1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
1002887880_1002887890 20 Left 1002887880 6:1312222-1312244 CCTTCCCCCACGGTGGCACGCAC No data
Right 1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
1002887884_1002887890 13 Left 1002887884 6:1312229-1312251 CCACGGTGGCACGCACATCATCC No data
Right 1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
1002887879_1002887890 25 Left 1002887879 6:1312217-1312239 CCGGACCTTCCCCCACGGTGGCA No data
Right 1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
1002887883_1002887890 14 Left 1002887883 6:1312228-1312250 CCCACGGTGGCACGCACATCATC No data
Right 1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 42
1002887882_1002887890 15 Left 1002887882 6:1312227-1312249 CCCCACGGTGGCACGCACATCAT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002887890 Original CRISPR TGCCCCGAAGACGCCCGCGC GGG Intergenic
900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG + Intronic
900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG + Intronic
900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG + Intronic
901506690 1:9689734-9689756 GACCCCGCAGACGCCCGCACAGG - Intronic
907298505 1:53470708-53470730 TGTCCTGAAGAAGCCGGCGCCGG - Intergenic
1067369878 10:45673002-45673024 TGCCCTCCAGACGCCCGCGTGGG - Intergenic
1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG + Intergenic
1076858565 10:133129064-133129086 TGCCCTGAAGGCACCCGTGCAGG - Exonic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1089993493 11:122883088-122883110 CGTCCCGAAGGCTCCCGCGCCGG - Intronic
1095947152 12:47759691-47759713 TGGGGCGAAGAGGCCCGCGCTGG - Intronic
1110925763 13:81149537-81149559 TGCCCCCCAGACCCCAGCGCAGG - Intergenic
1115610783 14:35046704-35046726 TGCTCGGAGGACGGCCGCGCAGG - Intronic
1115755139 14:36521353-36521375 TGCCTCCAAGACACCCGCGCTGG + Intergenic
1132553923 16:564533-564555 GACCCCGAGGACCCCCGCGCTGG - Intronic
1136428208 16:30183229-30183251 GGCCCCGCAGACGCGAGCGCAGG - Intronic
1142598308 17:1040189-1040211 GGCCCCCAGGACGCACGCGCAGG + Intronic
1146229348 17:31094856-31094878 TGCCGCGCATGCGCCCGCGCCGG - Intergenic
1147312592 17:39604244-39604266 TGCCCCCCGGACGCCGGCGCCGG + Intronic
1151887739 17:76933070-76933092 TCCACCGAAGACGCCCTTGCTGG - Intronic
1152918055 17:83052073-83052095 TCCCCCGTAGACGCCGCCGCGGG + Intergenic
1162527387 19:11214368-11214390 TGCCCCCAAGACGCTCTCCCGGG + Exonic
1163241619 19:16067270-16067292 TGCCCGGGACACGCCCACGCGGG + Intronic
1164692638 19:30222599-30222621 AGCCCCGCAGACGGCCGGGCAGG - Intergenic
1179960053 21:44763074-44763096 TGCTCCAAAGACGCCCCCACAGG + Intergenic
950043243 3:9933521-9933543 TCCCCCGGGGACTCCCGCGCCGG + Exonic
951217726 3:20040497-20040519 TGCCCCGCAGCCGCCCGGCCCGG - Exonic
953526027 3:43690872-43690894 TGCGCGGAAGACGCATGCGCTGG + Exonic
953897340 3:46812404-46812426 TGGCTCGAAGAGGCCCGGGCAGG - Exonic
953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG + Intronic
957193733 3:77040971-77040993 TGCCCCCAAGGAGCCCGTGCCGG - Intronic
968761021 4:2442852-2442874 TGCCCCCAAGGCCACCGCGCAGG - Intronic
977666464 4:99651009-99651031 TGCCCCCAATAAGCCCGAGCAGG - Exonic
987379895 5:17275513-17275535 GCCCCCGAAGGCGCCCGAGCAGG + Exonic
993905610 5:93620669-93620691 TGCCCTGAAGGAGACCGCGCGGG - Exonic
998877862 5:146618666-146618688 TGCCCAGAAGCAGCCCGCTCTGG - Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1002926695 6:1609453-1609475 AGCCCCGCCGACGCCAGCGCTGG - Intergenic
1015626009 6:135181515-135181537 TGGCCCGAAGACCCCGGCACAGG + Exonic
1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG + Exonic
1022582006 7:31564826-31564848 TGCCCTGAAGACACCTGGGCCGG + Intronic
1032117090 7:129126591-129126613 TGCCTCGGAGGCGCCCTCGCTGG - Intergenic
1041108710 8:54466435-54466457 AGCGCCTCAGACGCCCGCGCAGG - Intergenic
1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG + Intergenic
1049709338 8:144056632-144056654 TGCCCCGAAGTCCCCCGCACGGG + Exonic
1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG + Intronic
1200101020 X:153689073-153689095 TGCCCCCCAGACTCCCGGGCTGG + Intronic