ID: 1002887892 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:1312268-1312290 |
| Sequence | GGTCCCGCGCGGGCGTCTTC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 52 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 42} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1002887892_1002887900 | 6 | Left | 1002887892 | 6:1312268-1312290 | CCCGAAGACGCCCGCGCGGGACC | 0: 1 1: 0 2: 0 3: 9 4: 42 |
||
| Right | 1002887900 | 6:1312297-1312319 | CGCCAGTGAAGAACCCCTCCTGG | 0: 1 1: 0 2: 0 3: 7 4: 58 |
||||
| 1002887892_1002887901 | 7 | Left | 1002887892 | 6:1312268-1312290 | CCCGAAGACGCCCGCGCGGGACC | 0: 1 1: 0 2: 0 3: 9 4: 42 |
||
| Right | 1002887901 | 6:1312298-1312320 | GCCAGTGAAGAACCCCTCCTGGG | 0: 1 1: 0 2: 3 3: 11 4: 127 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1002887892 | Original CRISPR | GGTCCCGCGCGGGCGTCTTC GGG (reversed) | Intergenic | ||