ID: 1002887900

View in Genome Browser
Species Human (GRCh38)
Location 6:1312297-1312319
Sequence CGCCAGTGAAGAACCCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 58}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002887892_1002887900 6 Left 1002887892 6:1312268-1312290 CCCGAAGACGCCCGCGCGGGACC 0: 1
1: 0
2: 0
3: 9
4: 42
Right 1002887900 6:1312297-1312319 CGCCAGTGAAGAACCCCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 58
1002887887_1002887900 18 Left 1002887887 6:1312256-1312278 CCATTTCCGTGCCCCGAAGACGC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1002887900 6:1312297-1312319 CGCCAGTGAAGAACCCCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 58
1002887891_1002887900 7 Left 1002887891 6:1312267-1312289 CCCCGAAGACGCCCGCGCGGGAC 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1002887900 6:1312297-1312319 CGCCAGTGAAGAACCCCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 58
1002887888_1002887900 12 Left 1002887888 6:1312262-1312284 CCGTGCCCCGAAGACGCCCGCGC 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1002887900 6:1312297-1312319 CGCCAGTGAAGAACCCCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 58
1002887893_1002887900 5 Left 1002887893 6:1312269-1312291 CCGAAGACGCCCGCGCGGGACCT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1002887900 6:1312297-1312319 CGCCAGTGAAGAACCCCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 58
1002887896_1002887900 -4 Left 1002887896 6:1312278-1312300 CCCGCGCGGGACCTGGGACCGCC 0: 1
1: 1
2: 1
3: 15
4: 115
Right 1002887900 6:1312297-1312319 CGCCAGTGAAGAACCCCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 58
1002887897_1002887900 -5 Left 1002887897 6:1312279-1312301 CCGCGCGGGACCTGGGACCGCCA 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1002887900 6:1312297-1312319 CGCCAGTGAAGAACCCCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 58
1002887886_1002887900 24 Left 1002887886 6:1312250-1312272 CCGGCACCATTTCCGTGCCCCGA No data
Right 1002887900 6:1312297-1312319 CGCCAGTGAAGAACCCCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002887900 Original CRISPR CGCCAGTGAAGAACCCCTCC TGG Intergenic