ID: 1002895772

View in Genome Browser
Species Human (GRCh38)
Location 6:1379295-1379317
Sequence CAGGGTATTCTGGAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002895766_1002895772 0 Left 1002895766 6:1379272-1379294 CCAGATCACGTAGGTGGTAAGTG No data
Right 1002895772 6:1379295-1379317 CAGGGTATTCTGGAGCAGGAGGG No data
1002895763_1002895772 28 Left 1002895763 6:1379244-1379266 CCGAGGTGCAGAAACAAAGTAAC No data
Right 1002895772 6:1379295-1379317 CAGGGTATTCTGGAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002895772 Original CRISPR CAGGGTATTCTGGAGCAGGA GGG Intergenic
No off target data available for this crispr