ID: 1002895889

View in Genome Browser
Species Human (GRCh38)
Location 6:1379894-1379916
Sequence TCTAGGGCTCCACTGCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002895889_1002895897 14 Left 1002895889 6:1379894-1379916 CCTCTTTGCAGTGGAGCCCTAGA No data
Right 1002895897 6:1379931-1379953 CCCGAAAACACCCGGAGACCAGG No data
1002895889_1002895900 22 Left 1002895889 6:1379894-1379916 CCTCTTTGCAGTGGAGCCCTAGA No data
Right 1002895900 6:1379939-1379961 CACCCGGAGACCAGGGACCCCGG No data
1002895889_1002895899 15 Left 1002895889 6:1379894-1379916 CCTCTTTGCAGTGGAGCCCTAGA No data
Right 1002895899 6:1379932-1379954 CCGAAAACACCCGGAGACCAGGG No data
1002895889_1002895893 6 Left 1002895889 6:1379894-1379916 CCTCTTTGCAGTGGAGCCCTAGA No data
Right 1002895893 6:1379923-1379945 ACCCACAGCCCGAAAACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002895889 Original CRISPR TCTAGGGCTCCACTGCAAAG AGG (reversed) Intergenic
No off target data available for this crispr