ID: 1002896198

View in Genome Browser
Species Human (GRCh38)
Location 6:1381964-1381986
Sequence GGCCGCGATTCCCGAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002896193_1002896198 -3 Left 1002896193 6:1381944-1381966 CCGCGCCGGGCAGCCCCGCGGGC No data
Right 1002896198 6:1381964-1381986 GGCCGCGATTCCCGAGAGCCTGG No data
1002896194_1002896198 -8 Left 1002896194 6:1381949-1381971 CCGGGCAGCCCCGCGGGCCGCGA No data
Right 1002896198 6:1381964-1381986 GGCCGCGATTCCCGAGAGCCTGG No data
1002896188_1002896198 14 Left 1002896188 6:1381927-1381949 CCGCGAGCAGGTGACGGCCGCGC No data
Right 1002896198 6:1381964-1381986 GGCCGCGATTCCCGAGAGCCTGG No data
1002896186_1002896198 21 Left 1002896186 6:1381920-1381942 CCGGGAGCCGCGAGCAGGTGACG No data
Right 1002896198 6:1381964-1381986 GGCCGCGATTCCCGAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002896198 Original CRISPR GGCCGCGATTCCCGAGAGCC TGG Intergenic