ID: 1002897461

View in Genome Browser
Species Human (GRCh38)
Location 6:1388073-1388095
Sequence CTGCTCCTGGCTGAGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897461_1002897464 -6 Left 1002897461 6:1388073-1388095 CCAGCACACTCAGCCAGGAGCAG No data
Right 1002897464 6:1388090-1388112 GAGCAGTCCCCCGGCACTCCAGG No data
1002897461_1002897476 23 Left 1002897461 6:1388073-1388095 CCAGCACACTCAGCCAGGAGCAG No data
Right 1002897476 6:1388119-1388141 CAGGGCTCCTGCCGCCCCAGGGG No data
1002897461_1002897466 -4 Left 1002897461 6:1388073-1388095 CCAGCACACTCAGCCAGGAGCAG No data
Right 1002897466 6:1388092-1388114 GCAGTCCCCCGGCACTCCAGGGG No data
1002897461_1002897475 22 Left 1002897461 6:1388073-1388095 CCAGCACACTCAGCCAGGAGCAG No data
Right 1002897475 6:1388118-1388140 ACAGGGCTCCTGCCGCCCCAGGG No data
1002897461_1002897465 -5 Left 1002897461 6:1388073-1388095 CCAGCACACTCAGCCAGGAGCAG No data
Right 1002897465 6:1388091-1388113 AGCAGTCCCCCGGCACTCCAGGG No data
1002897461_1002897477 24 Left 1002897461 6:1388073-1388095 CCAGCACACTCAGCCAGGAGCAG No data
Right 1002897477 6:1388120-1388142 AGGGCTCCTGCCGCCCCAGGGGG No data
1002897461_1002897471 4 Left 1002897461 6:1388073-1388095 CCAGCACACTCAGCCAGGAGCAG No data
Right 1002897471 6:1388100-1388122 CCGGCACTCCAGGGGCACACAGG No data
1002897461_1002897472 5 Left 1002897461 6:1388073-1388095 CCAGCACACTCAGCCAGGAGCAG No data
Right 1002897472 6:1388101-1388123 CGGCACTCCAGGGGCACACAGGG No data
1002897461_1002897474 21 Left 1002897461 6:1388073-1388095 CCAGCACACTCAGCCAGGAGCAG No data
Right 1002897474 6:1388117-1388139 CACAGGGCTCCTGCCGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897461 Original CRISPR CTGCTCCTGGCTGAGTGTGC TGG (reversed) Intergenic