ID: 1002897463

View in Genome Browser
Species Human (GRCh38)
Location 6:1388086-1388108
Sequence GAGTGCCGGGGGACTGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897463_1002897472 -8 Left 1002897463 6:1388086-1388108 CCAGGAGCAGTCCCCCGGCACTC No data
Right 1002897472 6:1388101-1388123 CGGCACTCCAGGGGCACACAGGG No data
1002897463_1002897480 21 Left 1002897463 6:1388086-1388108 CCAGGAGCAGTCCCCCGGCACTC No data
Right 1002897480 6:1388130-1388152 CCGCCCCAGGGGGCCTGCCTAGG No data
1002897463_1002897471 -9 Left 1002897463 6:1388086-1388108 CCAGGAGCAGTCCCCCGGCACTC No data
Right 1002897471 6:1388100-1388122 CCGGCACTCCAGGGGCACACAGG No data
1002897463_1002897476 10 Left 1002897463 6:1388086-1388108 CCAGGAGCAGTCCCCCGGCACTC No data
Right 1002897476 6:1388119-1388141 CAGGGCTCCTGCCGCCCCAGGGG No data
1002897463_1002897484 29 Left 1002897463 6:1388086-1388108 CCAGGAGCAGTCCCCCGGCACTC No data
Right 1002897484 6:1388138-1388160 GGGGGCCTGCCTAGGCTGTGCGG No data
1002897463_1002897474 8 Left 1002897463 6:1388086-1388108 CCAGGAGCAGTCCCCCGGCACTC No data
Right 1002897474 6:1388117-1388139 CACAGGGCTCCTGCCGCCCCAGG No data
1002897463_1002897477 11 Left 1002897463 6:1388086-1388108 CCAGGAGCAGTCCCCCGGCACTC No data
Right 1002897477 6:1388120-1388142 AGGGCTCCTGCCGCCCCAGGGGG No data
1002897463_1002897475 9 Left 1002897463 6:1388086-1388108 CCAGGAGCAGTCCCCCGGCACTC No data
Right 1002897475 6:1388118-1388140 ACAGGGCTCCTGCCGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897463 Original CRISPR GAGTGCCGGGGGACTGCTCC TGG (reversed) Intergenic