ID: 1002897467

View in Genome Browser
Species Human (GRCh38)
Location 6:1388097-1388119
Sequence GTGTGCCCCTGGAGTGCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897467_1002897474 -3 Left 1002897467 6:1388097-1388119 CCCCCGGCACTCCAGGGGCACAC No data
Right 1002897474 6:1388117-1388139 CACAGGGCTCCTGCCGCCCCAGG No data
1002897467_1002897477 0 Left 1002897467 6:1388097-1388119 CCCCCGGCACTCCAGGGGCACAC No data
Right 1002897477 6:1388120-1388142 AGGGCTCCTGCCGCCCCAGGGGG No data
1002897467_1002897476 -1 Left 1002897467 6:1388097-1388119 CCCCCGGCACTCCAGGGGCACAC No data
Right 1002897476 6:1388119-1388141 CAGGGCTCCTGCCGCCCCAGGGG No data
1002897467_1002897487 27 Left 1002897467 6:1388097-1388119 CCCCCGGCACTCCAGGGGCACAC No data
Right 1002897487 6:1388147-1388169 CCTAGGCTGTGCGGCTGTGAAGG No data
1002897467_1002897484 18 Left 1002897467 6:1388097-1388119 CCCCCGGCACTCCAGGGGCACAC No data
Right 1002897484 6:1388138-1388160 GGGGGCCTGCCTAGGCTGTGCGG No data
1002897467_1002897475 -2 Left 1002897467 6:1388097-1388119 CCCCCGGCACTCCAGGGGCACAC No data
Right 1002897475 6:1388118-1388140 ACAGGGCTCCTGCCGCCCCAGGG No data
1002897467_1002897480 10 Left 1002897467 6:1388097-1388119 CCCCCGGCACTCCAGGGGCACAC No data
Right 1002897480 6:1388130-1388152 CCGCCCCAGGGGGCCTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897467 Original CRISPR GTGTGCCCCTGGAGTGCCGG GGG (reversed) Intergenic
No off target data available for this crispr