ID: 1002897473

View in Genome Browser
Species Human (GRCh38)
Location 6:1388108-1388130
Sequence GCAGGAGCCCTGTGTGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897473_1002897480 -1 Left 1002897473 6:1388108-1388130 CCAGGGGCACACAGGGCTCCTGC No data
Right 1002897480 6:1388130-1388152 CCGCCCCAGGGGGCCTGCCTAGG No data
1002897473_1002897487 16 Left 1002897473 6:1388108-1388130 CCAGGGGCACACAGGGCTCCTGC No data
Right 1002897487 6:1388147-1388169 CCTAGGCTGTGCGGCTGTGAAGG No data
1002897473_1002897488 28 Left 1002897473 6:1388108-1388130 CCAGGGGCACACAGGGCTCCTGC No data
Right 1002897488 6:1388159-1388181 GGCTGTGAAGGCTCTTTGCCTGG No data
1002897473_1002897484 7 Left 1002897473 6:1388108-1388130 CCAGGGGCACACAGGGCTCCTGC No data
Right 1002897484 6:1388138-1388160 GGGGGCCTGCCTAGGCTGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897473 Original CRISPR GCAGGAGCCCTGTGTGCCCC TGG (reversed) Intergenic