ID: 1002897474

View in Genome Browser
Species Human (GRCh38)
Location 6:1388117-1388139
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897457_1002897474 26 Left 1002897457 6:1388068-1388090 CCCCACCAGCACACTCAGCCAGG No data
Right 1002897474 6:1388117-1388139 CACAGGGCTCCTGCCGCCCCAGG No data
1002897470_1002897474 -6 Left 1002897470 6:1388100-1388122 CCGGCACTCCAGGGGCACACAGG No data
Right 1002897474 6:1388117-1388139 CACAGGGCTCCTGCCGCCCCAGG No data
1002897469_1002897474 -5 Left 1002897469 6:1388099-1388121 CCCGGCACTCCAGGGGCACACAG No data
Right 1002897474 6:1388117-1388139 CACAGGGCTCCTGCCGCCCCAGG No data
1002897460_1002897474 24 Left 1002897460 6:1388070-1388092 CCACCAGCACACTCAGCCAGGAG No data
Right 1002897474 6:1388117-1388139 CACAGGGCTCCTGCCGCCCCAGG No data
1002897461_1002897474 21 Left 1002897461 6:1388073-1388095 CCAGCACACTCAGCCAGGAGCAG No data
Right 1002897474 6:1388117-1388139 CACAGGGCTCCTGCCGCCCCAGG No data
1002897468_1002897474 -4 Left 1002897468 6:1388098-1388120 CCCCGGCACTCCAGGGGCACACA No data
Right 1002897474 6:1388117-1388139 CACAGGGCTCCTGCCGCCCCAGG No data
1002897467_1002897474 -3 Left 1002897467 6:1388097-1388119 CCCCCGGCACTCCAGGGGCACAC No data
Right 1002897474 6:1388117-1388139 CACAGGGCTCCTGCCGCCCCAGG No data
1002897463_1002897474 8 Left 1002897463 6:1388086-1388108 CCAGGAGCAGTCCCCCGGCACTC No data
Right 1002897474 6:1388117-1388139 CACAGGGCTCCTGCCGCCCCAGG No data
1002897459_1002897474 25 Left 1002897459 6:1388069-1388091 CCCACCAGCACACTCAGCCAGGA No data
Right 1002897474 6:1388117-1388139 CACAGGGCTCCTGCCGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897474 Original CRISPR CACAGGGCTCCTGCCGCCCC AGG Intergenic
No off target data available for this crispr