ID: 1002897476

View in Genome Browser
Species Human (GRCh38)
Location 6:1388119-1388141
Sequence CAGGGCTCCTGCCGCCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897469_1002897476 -3 Left 1002897469 6:1388099-1388121 CCCGGCACTCCAGGGGCACACAG No data
Right 1002897476 6:1388119-1388141 CAGGGCTCCTGCCGCCCCAGGGG No data
1002897460_1002897476 26 Left 1002897460 6:1388070-1388092 CCACCAGCACACTCAGCCAGGAG No data
Right 1002897476 6:1388119-1388141 CAGGGCTCCTGCCGCCCCAGGGG No data
1002897470_1002897476 -4 Left 1002897470 6:1388100-1388122 CCGGCACTCCAGGGGCACACAGG No data
Right 1002897476 6:1388119-1388141 CAGGGCTCCTGCCGCCCCAGGGG No data
1002897457_1002897476 28 Left 1002897457 6:1388068-1388090 CCCCACCAGCACACTCAGCCAGG No data
Right 1002897476 6:1388119-1388141 CAGGGCTCCTGCCGCCCCAGGGG No data
1002897467_1002897476 -1 Left 1002897467 6:1388097-1388119 CCCCCGGCACTCCAGGGGCACAC No data
Right 1002897476 6:1388119-1388141 CAGGGCTCCTGCCGCCCCAGGGG No data
1002897463_1002897476 10 Left 1002897463 6:1388086-1388108 CCAGGAGCAGTCCCCCGGCACTC No data
Right 1002897476 6:1388119-1388141 CAGGGCTCCTGCCGCCCCAGGGG No data
1002897459_1002897476 27 Left 1002897459 6:1388069-1388091 CCCACCAGCACACTCAGCCAGGA No data
Right 1002897476 6:1388119-1388141 CAGGGCTCCTGCCGCCCCAGGGG No data
1002897468_1002897476 -2 Left 1002897468 6:1388098-1388120 CCCCGGCACTCCAGGGGCACACA No data
Right 1002897476 6:1388119-1388141 CAGGGCTCCTGCCGCCCCAGGGG No data
1002897461_1002897476 23 Left 1002897461 6:1388073-1388095 CCAGCACACTCAGCCAGGAGCAG No data
Right 1002897476 6:1388119-1388141 CAGGGCTCCTGCCGCCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897476 Original CRISPR CAGGGCTCCTGCCGCCCCAG GGG Intergenic