ID: 1002897479

View in Genome Browser
Species Human (GRCh38)
Location 6:1388130-1388152
Sequence CCTAGGCAGGCCCCCTGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897479_1002897488 6 Left 1002897479 6:1388130-1388152 CCGCCCCAGGGGGCCTGCCTAGG No data
Right 1002897488 6:1388159-1388181 GGCTGTGAAGGCTCTTTGCCTGG No data
1002897479_1002897487 -6 Left 1002897479 6:1388130-1388152 CCGCCCCAGGGGGCCTGCCTAGG No data
Right 1002897487 6:1388147-1388169 CCTAGGCTGTGCGGCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897479 Original CRISPR CCTAGGCAGGCCCCCTGGGG CGG (reversed) Intergenic