ID: 1002897480

View in Genome Browser
Species Human (GRCh38)
Location 6:1388130-1388152
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897467_1002897480 10 Left 1002897467 6:1388097-1388119 CCCCCGGCACTCCAGGGGCACAC No data
Right 1002897480 6:1388130-1388152 CCGCCCCAGGGGGCCTGCCTAGG No data
1002897470_1002897480 7 Left 1002897470 6:1388100-1388122 CCGGCACTCCAGGGGCACACAGG No data
Right 1002897480 6:1388130-1388152 CCGCCCCAGGGGGCCTGCCTAGG No data
1002897469_1002897480 8 Left 1002897469 6:1388099-1388121 CCCGGCACTCCAGGGGCACACAG No data
Right 1002897480 6:1388130-1388152 CCGCCCCAGGGGGCCTGCCTAGG No data
1002897473_1002897480 -1 Left 1002897473 6:1388108-1388130 CCAGGGGCACACAGGGCTCCTGC No data
Right 1002897480 6:1388130-1388152 CCGCCCCAGGGGGCCTGCCTAGG No data
1002897463_1002897480 21 Left 1002897463 6:1388086-1388108 CCAGGAGCAGTCCCCCGGCACTC No data
Right 1002897480 6:1388130-1388152 CCGCCCCAGGGGGCCTGCCTAGG No data
1002897468_1002897480 9 Left 1002897468 6:1388098-1388120 CCCCGGCACTCCAGGGGCACACA No data
Right 1002897480 6:1388130-1388152 CCGCCCCAGGGGGCCTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897480 Original CRISPR CCGCCCCAGGGGGCCTGCCT AGG Intergenic
No off target data available for this crispr