ID: 1002897481

View in Genome Browser
Species Human (GRCh38)
Location 6:1388133-1388155
Sequence CAGCCTAGGCAGGCCCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897481_1002897488 3 Left 1002897481 6:1388133-1388155 CCCCAGGGGGCCTGCCTAGGCTG No data
Right 1002897488 6:1388159-1388181 GGCTGTGAAGGCTCTTTGCCTGG No data
1002897481_1002897487 -9 Left 1002897481 6:1388133-1388155 CCCCAGGGGGCCTGCCTAGGCTG No data
Right 1002897487 6:1388147-1388169 CCTAGGCTGTGCGGCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897481 Original CRISPR CAGCCTAGGCAGGCCCCCTG GGG (reversed) Intergenic