ID: 1002897482

View in Genome Browser
Species Human (GRCh38)
Location 6:1388134-1388156
Sequence ACAGCCTAGGCAGGCCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897482_1002897488 2 Left 1002897482 6:1388134-1388156 CCCAGGGGGCCTGCCTAGGCTGT No data
Right 1002897488 6:1388159-1388181 GGCTGTGAAGGCTCTTTGCCTGG No data
1002897482_1002897487 -10 Left 1002897482 6:1388134-1388156 CCCAGGGGGCCTGCCTAGGCTGT No data
Right 1002897487 6:1388147-1388169 CCTAGGCTGTGCGGCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897482 Original CRISPR ACAGCCTAGGCAGGCCCCCT GGG (reversed) Intergenic
No off target data available for this crispr