ID: 1002897485

View in Genome Browser
Species Human (GRCh38)
Location 6:1388143-1388165
Sequence CACAGCCGCACAGCCTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897485_1002897488 -7 Left 1002897485 6:1388143-1388165 CCTGCCTAGGCTGTGCGGCTGTG No data
Right 1002897488 6:1388159-1388181 GGCTGTGAAGGCTCTTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897485 Original CRISPR CACAGCCGCACAGCCTAGGC AGG (reversed) Intergenic