ID: 1002897487

View in Genome Browser
Species Human (GRCh38)
Location 6:1388147-1388169
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897482_1002897487 -10 Left 1002897482 6:1388134-1388156 CCCAGGGGGCCTGCCTAGGCTGT No data
Right 1002897487 6:1388147-1388169 CCTAGGCTGTGCGGCTGTGAAGG No data
1002897478_1002897487 -2 Left 1002897478 6:1388126-1388148 CCTGCCGCCCCAGGGGGCCTGCC No data
Right 1002897487 6:1388147-1388169 CCTAGGCTGTGCGGCTGTGAAGG No data
1002897469_1002897487 25 Left 1002897469 6:1388099-1388121 CCCGGCACTCCAGGGGCACACAG No data
Right 1002897487 6:1388147-1388169 CCTAGGCTGTGCGGCTGTGAAGG No data
1002897467_1002897487 27 Left 1002897467 6:1388097-1388119 CCCCCGGCACTCCAGGGGCACAC No data
Right 1002897487 6:1388147-1388169 CCTAGGCTGTGCGGCTGTGAAGG No data
1002897470_1002897487 24 Left 1002897470 6:1388100-1388122 CCGGCACTCCAGGGGCACACAGG No data
Right 1002897487 6:1388147-1388169 CCTAGGCTGTGCGGCTGTGAAGG No data
1002897481_1002897487 -9 Left 1002897481 6:1388133-1388155 CCCCAGGGGGCCTGCCTAGGCTG No data
Right 1002897487 6:1388147-1388169 CCTAGGCTGTGCGGCTGTGAAGG No data
1002897473_1002897487 16 Left 1002897473 6:1388108-1388130 CCAGGGGCACACAGGGCTCCTGC No data
Right 1002897487 6:1388147-1388169 CCTAGGCTGTGCGGCTGTGAAGG No data
1002897468_1002897487 26 Left 1002897468 6:1388098-1388120 CCCCGGCACTCCAGGGGCACACA No data
Right 1002897487 6:1388147-1388169 CCTAGGCTGTGCGGCTGTGAAGG No data
1002897479_1002897487 -6 Left 1002897479 6:1388130-1388152 CCGCCCCAGGGGGCCTGCCTAGG No data
Right 1002897487 6:1388147-1388169 CCTAGGCTGTGCGGCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897487 Original CRISPR CCTAGGCTGTGCGGCTGTGA AGG Intergenic