ID: 1002897488

View in Genome Browser
Species Human (GRCh38)
Location 6:1388159-1388181
Sequence GGCTGTGAAGGCTCTTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897481_1002897488 3 Left 1002897481 6:1388133-1388155 CCCCAGGGGGCCTGCCTAGGCTG No data
Right 1002897488 6:1388159-1388181 GGCTGTGAAGGCTCTTTGCCTGG No data
1002897485_1002897488 -7 Left 1002897485 6:1388143-1388165 CCTGCCTAGGCTGTGCGGCTGTG No data
Right 1002897488 6:1388159-1388181 GGCTGTGAAGGCTCTTTGCCTGG No data
1002897483_1002897488 1 Left 1002897483 6:1388135-1388157 CCAGGGGGCCTGCCTAGGCTGTG No data
Right 1002897488 6:1388159-1388181 GGCTGTGAAGGCTCTTTGCCTGG No data
1002897479_1002897488 6 Left 1002897479 6:1388130-1388152 CCGCCCCAGGGGGCCTGCCTAGG No data
Right 1002897488 6:1388159-1388181 GGCTGTGAAGGCTCTTTGCCTGG No data
1002897478_1002897488 10 Left 1002897478 6:1388126-1388148 CCTGCCGCCCCAGGGGGCCTGCC No data
Right 1002897488 6:1388159-1388181 GGCTGTGAAGGCTCTTTGCCTGG No data
1002897482_1002897488 2 Left 1002897482 6:1388134-1388156 CCCAGGGGGCCTGCCTAGGCTGT No data
Right 1002897488 6:1388159-1388181 GGCTGTGAAGGCTCTTTGCCTGG No data
1002897473_1002897488 28 Left 1002897473 6:1388108-1388130 CCAGGGGCACACAGGGCTCCTGC No data
Right 1002897488 6:1388159-1388181 GGCTGTGAAGGCTCTTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897488 Original CRISPR GGCTGTGAAGGCTCTTTGCC TGG Intergenic