ID: 1002897498

View in Genome Browser
Species Human (GRCh38)
Location 6:1388225-1388247
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897498_1002897513 25 Left 1002897498 6:1388225-1388247 CCTGCAACTCCCCAGGCTCCCCA No data
Right 1002897513 6:1388273-1388295 CTTTCAGCCTAGACGCAGCGGGG No data
1002897498_1002897506 0 Left 1002897498 6:1388225-1388247 CCTGCAACTCCCCAGGCTCCCCA No data
Right 1002897506 6:1388248-1388270 GCAGGCACACCCGTGCACCTCGG No data
1002897498_1002897512 24 Left 1002897498 6:1388225-1388247 CCTGCAACTCCCCAGGCTCCCCA No data
Right 1002897512 6:1388272-1388294 CCTTTCAGCCTAGACGCAGCGGG No data
1002897498_1002897510 23 Left 1002897498 6:1388225-1388247 CCTGCAACTCCCCAGGCTCCCCA No data
Right 1002897510 6:1388271-1388293 TCCTTTCAGCCTAGACGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897498 Original CRISPR TGGGGAGCCTGGGGAGTTGC AGG (reversed) Intergenic
No off target data available for this crispr