ID: 1002897503

View in Genome Browser
Species Human (GRCh38)
Location 6:1388243-1388265
Sequence GTGCACGGGTGTGCCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897503_1002897512 6 Left 1002897503 6:1388243-1388265 CCCCAGCAGGCACACCCGTGCAC No data
Right 1002897512 6:1388272-1388294 CCTTTCAGCCTAGACGCAGCGGG No data
1002897503_1002897513 7 Left 1002897503 6:1388243-1388265 CCCCAGCAGGCACACCCGTGCAC No data
Right 1002897513 6:1388273-1388295 CTTTCAGCCTAGACGCAGCGGGG No data
1002897503_1002897510 5 Left 1002897503 6:1388243-1388265 CCCCAGCAGGCACACCCGTGCAC No data
Right 1002897510 6:1388271-1388293 TCCTTTCAGCCTAGACGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897503 Original CRISPR GTGCACGGGTGTGCCTGCTG GGG (reversed) Intergenic
No off target data available for this crispr