ID: 1002897508

View in Genome Browser
Species Human (GRCh38)
Location 6:1388258-1388280
Sequence GCTGAAAGGACCGAGGTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897508_1002897510 -10 Left 1002897508 6:1388258-1388280 CCGTGCACCTCGGTCCTTTCAGC No data
Right 1002897510 6:1388271-1388293 TCCTTTCAGCCTAGACGCAGCGG No data
1002897508_1002897512 -9 Left 1002897508 6:1388258-1388280 CCGTGCACCTCGGTCCTTTCAGC No data
Right 1002897512 6:1388272-1388294 CCTTTCAGCCTAGACGCAGCGGG No data
1002897508_1002897515 16 Left 1002897508 6:1388258-1388280 CCGTGCACCTCGGTCCTTTCAGC No data
Right 1002897515 6:1388297-1388319 GCCCAGCTCTACCTCCTGTTTGG No data
1002897508_1002897513 -8 Left 1002897508 6:1388258-1388280 CCGTGCACCTCGGTCCTTTCAGC No data
Right 1002897513 6:1388273-1388295 CTTTCAGCCTAGACGCAGCGGGG No data
1002897508_1002897518 24 Left 1002897508 6:1388258-1388280 CCGTGCACCTCGGTCCTTTCAGC No data
Right 1002897518 6:1388305-1388327 CTACCTCCTGTTTGGTCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897508 Original CRISPR GCTGAAAGGACCGAGGTGCA CGG (reversed) Intergenic
No off target data available for this crispr