ID: 1002897513

View in Genome Browser
Species Human (GRCh38)
Location 6:1388273-1388295
Sequence CTTTCAGCCTAGACGCAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897501_1002897513 15 Left 1002897501 6:1388235-1388257 CCCAGGCTCCCCAGCAGGCACAC No data
Right 1002897513 6:1388273-1388295 CTTTCAGCCTAGACGCAGCGGGG No data
1002897498_1002897513 25 Left 1002897498 6:1388225-1388247 CCTGCAACTCCCCAGGCTCCCCA No data
Right 1002897513 6:1388273-1388295 CTTTCAGCCTAGACGCAGCGGGG No data
1002897502_1002897513 14 Left 1002897502 6:1388236-1388258 CCAGGCTCCCCAGCAGGCACACC No data
Right 1002897513 6:1388273-1388295 CTTTCAGCCTAGACGCAGCGGGG No data
1002897500_1002897513 16 Left 1002897500 6:1388234-1388256 CCCCAGGCTCCCCAGCAGGCACA No data
Right 1002897513 6:1388273-1388295 CTTTCAGCCTAGACGCAGCGGGG No data
1002897504_1002897513 6 Left 1002897504 6:1388244-1388266 CCCAGCAGGCACACCCGTGCACC No data
Right 1002897513 6:1388273-1388295 CTTTCAGCCTAGACGCAGCGGGG No data
1002897497_1002897513 28 Left 1002897497 6:1388222-1388244 CCTCCTGCAACTCCCCAGGCTCC No data
Right 1002897513 6:1388273-1388295 CTTTCAGCCTAGACGCAGCGGGG No data
1002897503_1002897513 7 Left 1002897503 6:1388243-1388265 CCCCAGCAGGCACACCCGTGCAC No data
Right 1002897513 6:1388273-1388295 CTTTCAGCCTAGACGCAGCGGGG No data
1002897505_1002897513 5 Left 1002897505 6:1388245-1388267 CCAGCAGGCACACCCGTGCACCT No data
Right 1002897513 6:1388273-1388295 CTTTCAGCCTAGACGCAGCGGGG No data
1002897507_1002897513 -7 Left 1002897507 6:1388257-1388279 CCCGTGCACCTCGGTCCTTTCAG No data
Right 1002897513 6:1388273-1388295 CTTTCAGCCTAGACGCAGCGGGG No data
1002897508_1002897513 -8 Left 1002897508 6:1388258-1388280 CCGTGCACCTCGGTCCTTTCAGC No data
Right 1002897513 6:1388273-1388295 CTTTCAGCCTAGACGCAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897513 Original CRISPR CTTTCAGCCTAGACGCAGCG GGG Intergenic
No off target data available for this crispr