ID: 1002897936

View in Genome Browser
Species Human (GRCh38)
Location 6:1389977-1389999
Sequence GGCTGCACGCGCGGCGGAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002897936_1002897943 -2 Left 1002897936 6:1389977-1389999 CCCGCTCCGCCGCGCGTGCAGCC 0: 1
1: 0
2: 0
3: 9
4: 229
Right 1002897943 6:1389998-1390020 CCCGGTCCCCGGCGCGCTCCAGG 0: 1
1: 0
2: 0
3: 30
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002897936 Original CRISPR GGCTGCACGCGCGGCGGAGC GGG (reversed) Exonic
900512729 1:3068189-3068211 GGCTGCGCGAGCGCCCGAGCTGG - Intergenic
900552308 1:3263039-3263061 GGCTGCATGCCCAGAGGAGCTGG - Intronic
901019627 1:6249245-6249267 GTCTGCGCGCGGGGCGGAGGCGG + Exonic
901055573 1:6447381-6447403 GGCTGCAGGGGGCGCGGAGCGGG + Intronic
901234502 1:7660782-7660804 GGATCCAGGCGCGGAGGAGCCGG - Intronic
901526092 1:9824116-9824138 GGGAGCGCGCGCGGCGGACCCGG + Exonic
902478818 1:16701256-16701278 GGCTGCAGGGGGCGCGGAGCCGG - Intergenic
903233839 1:21937260-21937282 GGCTGCGGGCGGCGCGGAGCGGG - Exonic
903233996 1:21937642-21937664 GGCGGCGCGCGCGGGGAAGCGGG - Intergenic
903468397 1:23568213-23568235 GGCTGCGCGGGGGGCGGAGAGGG - Intergenic
903603053 1:24556117-24556139 GGCTGGGAGCGCGGCGGTGCCGG + Exonic
903743348 1:25571145-25571167 GGCTGCTGGCGAGGCAGAGCAGG - Intergenic
903750247 1:25616940-25616962 GGCTGCGCGCTCCGCGGAGCCGG + Intergenic
904045284 1:27604645-27604667 GGCTGCTGGGGCGGGGGAGCGGG + Intergenic
904642052 1:31938344-31938366 GGCTGCGCGCGCAGCGGTGGTGG - Exonic
905463076 1:38134016-38134038 GGCGGCCGGGGCGGCGGAGCAGG + Intergenic
907069327 1:51519402-51519424 GCCTGCCCGCCCGCCGGAGCCGG + Intergenic
909282219 1:73770411-73770433 GGCTGCATGCTCCACGGAGCTGG + Intergenic
910569459 1:88684076-88684098 GGCTGCCCTCGCCGCGGAGTCGG + Intergenic
910657424 1:89633039-89633061 GGCTGCGTGCGGGGCGGCGCTGG + Intergenic
917291576 1:173477180-173477202 GGCTGGGCGCGGGGCGGGGCTGG - Intergenic
917291586 1:173477202-173477224 GGCTGGGCGCGGGGCGGGGCGGG - Intergenic
917848937 1:179043459-179043481 GGCTGCACACTCCACGGAGCTGG - Intronic
918487623 1:185045806-185045828 GGCCGCTCTCGCGGCGGAGACGG + Intronic
919794107 1:201310855-201310877 GGCTGCACCTGCAGGGGAGCGGG - Intronic
920886988 1:209938517-209938539 GGCCGCACGCGGGGCAAAGCGGG + Intronic
922513142 1:226186462-226186484 GGCTGGGGGCGCGGCGGAGGAGG - Exonic
924732521 1:246724635-246724657 GGCTGCGCGGGCGGCTGGGCCGG + Intronic
924953486 1:248906563-248906585 GGCTGAGCGGGAGGCGGAGCGGG + Intronic
1065140355 10:22714018-22714040 GGGGGCACGCGCCGCGGGGCTGG + Intronic
1068474304 10:57506581-57506603 GGCTGCACGCTCCATGGAGCTGG + Intergenic
1068678452 10:59792990-59793012 GGCTGCATGGGTGGCGGAGGTGG + Exonic
1069090756 10:64196799-64196821 GGGACCACGCGCAGCGGAGCAGG + Intergenic
1071086971 10:81875756-81875778 GGCGGCACCCCCGGCGGAGGGGG - Exonic
1071997671 10:91163305-91163327 GGCTGGAGGCACGGCGGGGCCGG + Intronic
1073207344 10:101776111-101776133 GGCTGCTCGGGAGCCGGAGCGGG + Intronic
1076395462 10:130135333-130135355 GGCGGCACGCGCGGAGGGCCAGG + Intergenic
1077214362 11:1389283-1389305 TGCTGCACGCGCGGGGGATGGGG - Intergenic
1077321989 11:1946838-1946860 AGCTGCAAGCGCAGCGGTGCGGG + Intergenic
1080209921 11:29773848-29773870 GGCTGCATGTGCTGTGGAGCAGG - Intergenic
1083572699 11:63768761-63768783 GGCTGCTCGCTCGGCGGCGCGGG + Exonic
1083782806 11:64926727-64926749 AGCTGCACGAGCTGCTGAGCCGG + Exonic
1084030930 11:66480212-66480234 GGCCGCACACGCGCCGGACCGGG - Exonic
1084151340 11:67289283-67289305 GGCGGGGCGGGCGGCGGAGCGGG - Exonic
1084517014 11:69642760-69642782 GGCGGCGTGCGCGGCGGCGCGGG - Intronic
1084724779 11:70934412-70934434 GGCTGCACCCTGGGCGGGGCTGG - Intronic
1084860258 11:72013527-72013549 GGCTGAGCGTGCGGAGGAGCTGG - Exonic
1085212313 11:74791883-74791905 GGCTGTACGCTCCACGGAGCCGG - Intronic
1089604159 11:119632019-119632041 GGCTGCAAGGGCAGCAGAGCTGG + Intronic
1202805005 11_KI270721v1_random:2151-2173 AGCTGCAAGCGCAGCGGTGCGGG + Intergenic
1093183165 12:15989210-15989232 GGCTGCACACTCCGTGGAGCTGG - Intronic
1093525852 12:20102665-20102687 GGCTGCATGCCCTGTGGAGCTGG - Intergenic
1100847730 12:98678360-98678382 GGCTGCATGCTCTGTGGAGCTGG + Intronic
1102278359 12:111599398-111599420 AGCGGCCGGCGCGGCGGAGCGGG - Exonic
1103547500 12:121712658-121712680 CGCCGCACGCGGGGCGGGGCGGG + Intergenic
1103954121 12:124567208-124567230 GGCGGCGCACGCGGCGGAGTTGG - Intronic
1105690939 13:22838449-22838471 GGCTGCACAGGAGCCGGAGCCGG - Intergenic
1105943637 13:25171561-25171583 GTCAGCGAGCGCGGCGGAGCTGG - Exonic
1111202959 13:84962578-84962600 GGCTGCATGCTCTGAGGAGCCGG - Intergenic
1112050619 13:95641769-95641791 GGCCGCACCCGCGGCGGCGGCGG + Exonic
1112741030 13:102472675-102472697 GGCTGCATGCTCTGTGGAGCTGG - Intergenic
1115664811 14:35534698-35534720 GGCTGCTGGCGCCACGGAGCAGG - Exonic
1118293746 14:64549915-64549937 GGCTGCCCGGGGCGCGGAGCGGG - Exonic
1119850028 14:77860658-77860680 GGCTGCAAGCTGGGAGGAGCAGG + Intronic
1122300145 14:100726871-100726893 GGCGGCGCGCGCGGCGGCGGCGG + Exonic
1123893374 15:24803329-24803351 GGCTGCATGCTCCACGGAGCTGG - Intergenic
1125752230 15:42036753-42036775 AGCTGCATGCTCCGCGGAGCTGG + Intronic
1126766911 15:52019077-52019099 GGCTGCGCGCGCCGCGGAGGCGG - Intronic
1129796628 15:78382346-78382368 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1132305202 15:100807230-100807252 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1132426709 15:101724177-101724199 GGCTGCACAGGCGGTGGCGCAGG + Exonic
1132498213 16:273725-273747 GCCTGCAGGCGGGGCGGGGCAGG + Intronic
1132519792 16:381871-381893 GGCTGCCCGGGCGGCGGCGGGGG - Exonic
1132604565 16:788382-788404 GGCTGCGCGCGCAGCGGTGCAGG - Intronic
1132683752 16:1153842-1153864 GCCGGGACGCGAGGCGGAGCGGG + Exonic
1135537021 16:23302417-23302439 ACCTGCTCGGGCGGCGGAGCGGG - Exonic
1137280582 16:46973388-46973410 GGCTGCCCGCGAGCCGGCGCCGG - Intronic
1137412927 16:48244630-48244652 GGCTGCCCCCGCGGCGGCGGCGG + Intronic
1137531762 16:49282407-49282429 GCGTGCGCGCGCGGCGGGGCGGG + Intergenic
1137738313 16:50741716-50741738 GGGAGCACGGGAGGCGGAGCTGG + Intergenic
1138651657 16:58464367-58464389 GGCAGCGCGCTCGGCCGAGCCGG - Exonic
1140078649 16:71723992-71724014 GGCTGCGGGAGGGGCGGAGCTGG - Intronic
1141989631 16:87602641-87602663 GGCGGCACGGGCGGCGGCGCTGG - Intronic
1142940812 17:3378603-3378625 GGCTGCGTGCTCGGTGGAGCTGG - Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147684104 17:42276587-42276609 GGCGGCGCGCTCGGCGGTGCCGG + Intronic
1149330701 17:55577960-55577982 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1149610573 17:57955471-57955493 GGCTGCGGGCGGGGCGGGGCGGG + Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1149934569 17:60792222-60792244 GGCTGCATGCTCCACGGAGCCGG + Intronic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1152742226 17:82023358-82023380 GGCTGCAGGCGGGGCAGGGCTGG + Exonic
1156242523 18:35267531-35267553 GGCCGCACGCGCGCCGGAAGTGG + Exonic
1156275780 18:35581677-35581699 GGGGGCGGGCGCGGCGGAGCGGG + Intronic
1156298984 18:35818473-35818495 GGCTGCACGCTCCGTGGAGCTGG - Intergenic
1157279122 18:46334249-46334271 GGCTCCTCGCGCGGCGGCGGCGG - Exonic
1157319572 18:46623883-46623905 TGCTGCATGCACAGCGGAGCTGG + Intronic
1159036340 18:63281161-63281183 GGCTGCAGGCGTGGGGGAACAGG + Intronic
1160736147 19:663231-663253 CACGGCACGCGGGGCGGAGCGGG + Exonic
1161216756 19:3098540-3098562 GGCTGCTAGCGAGGCTGAGCCGG + Intronic
1163275861 19:16283835-16283857 GGCTGGACGCAGGGCCGAGCAGG + Intergenic
1163774826 19:19211975-19211997 GGCTGGACCCGGCGCGGAGCTGG + Exonic
1165157718 19:33797999-33798021 GGCTGGAGGCGCCGCGGGGCGGG - Intronic
1165433942 19:35786824-35786846 GGCAGCAGGCGAGGCGGGGCTGG - Intronic
1166975121 19:46601343-46601365 GCGCGGACGCGCGGCGGAGCTGG + Exonic
1167333951 19:48873314-48873336 GGCTCCAGGCGCGGCTGAGGAGG - Exonic
1167379330 19:49129506-49129528 GGCTGCCCACGGGGCGGAGCCGG + Intronic
1202712837 1_KI270714v1_random:27087-27109 GGCTGCAGGGGGCGCGGAGCCGG - Intergenic
925019129 2:554640-554662 GTCTCCACGCCCCGCGGAGCAGG - Intergenic
925019147 2:554692-554714 GTCTCCACGCCCCGCGGAGCAGG - Intergenic
927452763 2:23223096-23223118 GGCAGCATGCGGGGCAGAGCAGG + Intergenic
928432734 2:31234246-31234268 TGCTGCACGCAGGGCAGAGCAGG + Intergenic
929188728 2:39120782-39120804 GTCTGGCCCCGCGGCGGAGCTGG + Intronic
934539142 2:95159828-95159850 GGGTGCTGGCGCGGCGAAGCTGG + Intronic
934562092 2:95318612-95318634 GCCTGCACCCGGGGCTGAGCAGG + Intronic
941029116 2:160492773-160492795 GGCTGGAGGGGCGGCGGGGCCGG - Intronic
942618262 2:177817522-177817544 GGCAGCACGCCTGGCAGAGCTGG + Intronic
944483693 2:200181957-200181979 GACTGCACGCTCAGTGGAGCTGG + Intergenic
944632587 2:201642686-201642708 GCCTGCGCGCGCGACCGAGCCGG - Intronic
945330246 2:208530490-208530512 GGCTGCACACTCTGTGGAGCCGG - Intronic
946187030 2:217986912-217986934 GGCTGCACGCAGCGCGGAGGAGG + Intronic
947718208 2:232352290-232352312 GGCCGCAAGGGCGGCGGAGGTGG + Intergenic
1170617979 20:17969241-17969263 GTCCGCACCCACGGCGGAGCGGG + Intronic
1172100832 20:32483365-32483387 GGCTGGAAGCGAGGCGGAGATGG + Exonic
1172446815 20:34997502-34997524 GGCGGAGGGCGCGGCGGAGCTGG + Exonic
1172676537 20:36676841-36676863 GGCTGCACACGCCATGGAGCTGG + Intronic
1173843670 20:46174861-46174883 GGCAGCGCGGGCGGGGGAGCGGG - Exonic
1174287726 20:49484076-49484098 GGCTGCAGGCGCCGCGGGGCCGG + Intergenic
1174494556 20:50930741-50930763 GGCTGCACTGGCGGCCGCGCGGG + Intronic
1174494575 20:50930797-50930819 GGGTCCGCGCGCGGCGGCGCCGG + Intronic
1175847210 20:62065307-62065329 GGCGGCCAGCGCGGCGGGGCCGG + Exonic
1176301326 21:5100344-5100366 GGCTGGACACGCGGGGGGGCCGG - Intergenic
1177157440 21:17513287-17513309 TGCTGCAGGGGCGGCGGGGCGGG + Intronic
1178334650 21:31732218-31732240 CCCTGCACGCGGGGCGGTGCAGG - Intergenic
1178992265 21:37366347-37366369 GGCTGCGGGGGCGGCGGCGCGGG + Intronic
1179855705 21:44161555-44161577 GGCTGGACACGCGGGGGGGCCGG + Intergenic
1179967967 21:44817852-44817874 GGCGGGACGCGGGGCGGAGTCGG + Intronic
1181725130 22:24806225-24806247 TGCTGCAGCCGCGGCGGGGCGGG - Intronic
1182586603 22:31347071-31347093 GGCTGCGCGCCCGGAAGAGCTGG + Intergenic
1184035319 22:41915207-41915229 GGCAGCAGGCCCCGCGGAGCCGG + Intergenic
1184523499 22:45008815-45008837 GGCAGCTCGCGGGGCGGGGCGGG + Intronic
1184723259 22:46328331-46328353 AGCTGCATGCGAGGAGGAGCTGG + Intronic
1184759600 22:46537142-46537164 GGCAGCACGGGCGGCGGCGGCGG + Exonic
951803720 3:26623896-26623918 GGCTGCTCGTGCGGTGGAGGAGG + Intronic
952377821 3:32781652-32781674 GGCGGCACGGTCGGCGCAGCAGG + Intergenic
952383472 3:32821817-32821839 GGCTGGCCGGGCGGCGGCGCAGG - Intronic
952418971 3:33114410-33114432 GGCAGTGCGCGCGGCGCAGCAGG - Exonic
952706191 3:36380402-36380424 GGCCGCGGGCGCGGCGGGGCGGG + Exonic
953447368 3:42979601-42979623 GGCTGAGCGCGCCGAGGAGCCGG + Exonic
953638682 3:44685486-44685508 GGCTGCGCTGGCGGCGGGGCCGG - Intergenic
954401460 3:50321751-50321773 GGCTGGCGGCGCCGCGGAGCTGG - Exonic
957613917 3:82505205-82505227 GGCTGCATGCTCCACGGAGCTGG + Intergenic
958418605 3:93906581-93906603 GGCTGCACGTGCCATGGAGCTGG + Intronic
961780169 3:129316428-129316450 CGCTGCGGGCGCGGCGGCGCTGG - Intergenic
962786093 3:138769138-138769160 GGCTGCATGCTCTGTGGAGCTGG - Intronic
967118394 3:186361916-186361938 GGCGGCCGGCGCGGCGGAGGGGG - Intronic
968849601 4:3069952-3069974 GGATGCACGCGGGGTGGGGCTGG - Intergenic
968876642 4:3271364-3271386 GGCACCACGCCCGGCCGAGCGGG + Intronic
968911173 4:3477679-3477701 GGAGGCACGTGCGGCAGAGCTGG + Intronic
969016584 4:4107592-4107614 GGGTGCGCGCGGCGCGGAGCTGG + Intergenic
969113516 4:4857925-4857947 GGCTGGACGCGCGGTGCACCGGG - Intergenic
969203286 4:5622664-5622686 GGCTGCACGGGCCGAGCAGCTGG - Exonic
969513533 4:7633308-7633330 AGCTGGACGAGAGGCGGAGCAGG + Intronic
975485910 4:74933821-74933843 GGCTGCGCGCCTGGCGGGGCTGG + Intronic
975848923 4:78551946-78551968 AGCTGCACTCGCGGGGGAACTGG - Intronic
978347774 4:107789119-107789141 GGCTGCATGCTCTGCAGAGCTGG - Intergenic
980740629 4:136946326-136946348 GGCTGCACACTCCACGGAGCTGG + Intergenic
982773687 4:159420980-159421002 GGCTGCGCACTCGGCGCAGCTGG + Intergenic
984024118 4:174522522-174522544 GGCTGCACGCGCGCGCGCGCAGG - Exonic
984526873 4:180867449-180867471 GGCTGCACGCTCCACGGAGGTGG - Intergenic
985504596 5:271768-271790 TGCTGCAGGCGCGGCGCTGCCGG + Exonic
997129657 5:131264096-131264118 GGCGGCAGGAGCCGCGGAGCCGG + Exonic
997950920 5:138241975-138241997 GGCTGGCCGAGCGCCGGAGCTGG - Intergenic
998303616 5:141051647-141051669 GGCTGCGCGCGGGGCGCGGCTGG + Exonic
998658159 5:144205422-144205444 GGCTTCTCTGGCGGCGGAGCTGG - Exonic
1002691373 5:181053008-181053030 GGGGGCGCGCGCGGCGGAGGGGG - Intronic
1002691383 5:181053032-181053054 GGGAGCGCGCGCGGCGGAGGGGG - Intronic
1002897936 6:1389977-1389999 GGCTGCACGCGCGGCGGAGCGGG - Exonic
1003081333 6:3024024-3024046 GGCTGCATCCGGGGCGGGGCTGG + Intergenic
1003143853 6:3493477-3493499 GGCTGCAAGGACGGAGGAGCAGG + Intergenic
1005303840 6:24495289-24495311 GGCAGCGCGCACGGCGGCGCGGG - Exonic
1006396248 6:33789174-33789196 TCCCGCAGGCGCGGCGGAGCGGG + Intergenic
1007644438 6:43369475-43369497 GGCTGCTCCCGCGGCTGAGGCGG - Intronic
1011075168 6:83430994-83431016 GGCCGCACGCGCGGTGCAGGCGG + Exonic
1017726675 6:157281109-157281131 GGCCACACGCGCGGAGAAGCTGG - Intergenic
1019266609 7:120761-120783 GGCTGCAAGCCCAGCAGAGCAGG - Intergenic
1019559411 7:1648481-1648503 GGCTGCCTGCGGAGCGGAGCCGG + Intergenic
1022629374 7:32070899-32070921 CGCTGGGCGCGGGGCGGAGCCGG - Intronic
1025942231 7:66082905-66082927 AGCTGCACACGGGACGGAGCCGG + Exonic
1026523031 7:71132644-71132666 GGATGCTCGGGCGGCGGAGACGG - Exonic
1029073335 7:97917529-97917551 GGCTGCAGCCCCGGCTGAGCTGG - Intergenic
1029640513 7:101816683-101816705 TGCCGCCGGCGCGGCGGAGCTGG + Intronic
1030733447 7:113017365-113017387 GGCTGCACGCGCGGCGTTTGCGG + Intergenic
1034499381 7:151440083-151440105 GGCTGCACTCGCGGTGGCACAGG - Intronic
1035187580 7:157138676-157138698 GGCTGGGCACGCGGCGGAGTGGG - Intergenic
1035579546 8:731408-731430 GGCTGCGGGGGCGGCGGTGCGGG + Intronic
1035759505 8:2059064-2059086 GGCAGCAGGCGCGGGGGAGCTGG + Intronic
1038408519 8:27340728-27340750 GGCTGCAGGCAGGGCTGAGCTGG + Intronic
1038450599 8:27636760-27636782 GGCTGCATGGGCTGCGGGGCTGG + Intronic
1039921213 8:41895913-41895935 GGCTGCAGGCTCCGGGGAGCGGG - Intronic
1041357430 8:57014854-57014876 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1044259349 8:90098837-90098859 GGCTGCACGCACCATGGAGCCGG - Intergenic
1045516276 8:102863565-102863587 TGCTGGACGCTTGGCGGAGCCGG - Intronic
1049671193 8:143870596-143870618 TGCTGCCCGCACTGCGGAGCCGG - Exonic
1049697221 8:143990235-143990257 GGCAGGCCGCGCGGCGCAGCGGG - Exonic
1049761443 8:144333708-144333730 GGCGGCACGCGCGCGGGGGCAGG - Exonic
1050130360 9:2406337-2406359 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1050182211 9:2933922-2933944 GGCTGCAAGCTCCACGGAGCTGG + Intergenic
1050873982 9:10612910-10612932 GGCTGCGGGCGCGGCTGGGCGGG + Intergenic
1050947846 9:11549291-11549313 GGCTGCACGCTCCATGGAGCTGG + Intergenic
1051896427 9:21994283-21994305 GGCCGCACGCGCGCCGAATCCGG + Intronic
1055397544 9:75891083-75891105 GGCTGCTCGCCGGGCGGCGCAGG + Exonic
1057468378 9:95337029-95337051 GGCTGCATGCTCCGTGGAGCTGG + Intergenic
1057716806 9:97502017-97502039 GGCTGCGCGCGCGGGGAGGCGGG - Intronic
1058545931 9:106060059-106060081 GGCTGCATGCTCCGCAGAGCAGG - Intergenic
1059191854 9:112333917-112333939 GGCGGGGTGCGCGGCGGAGCGGG - Intergenic
1060479265 9:124008603-124008625 GGCTGCCGGCGCCACGGAGCCGG - Intronic
1060485862 9:124045764-124045786 GGCTGCCAGCGCGGGGGAGGCGG + Intergenic
1060629567 9:125143444-125143466 AGCAGCTCCCGCGGCGGAGCAGG - Exonic
1061836281 9:133332208-133332230 GCCTGCAGGCACGGCAGAGCCGG - Exonic
1062329004 9:136028591-136028613 GGCTGCACGCTCCATGGAGCTGG + Intronic
1062369332 9:136229384-136229406 GGATGCACGGGCTGAGGAGCCGG - Intronic
1062560503 9:137139527-137139549 CGCGGCACGGGCGACGGAGCAGG - Exonic
1197941653 X:131795999-131796021 GGCTGCAAGGTCGGCGGCGCGGG + Intergenic
1199500351 X:148500612-148500634 GGCTGCACAGGCGGCGGCGGCGG - Exonic
1199599313 X:149532527-149532549 GGCTGCACGCTGGGTGCAGCAGG - Intronic
1199651318 X:149947678-149947700 GGCTGCACGCTGGGTGCAGCAGG + Intergenic
1200045696 X:153400337-153400359 GGGTGCACGGGGTGCGGAGCCGG - Intergenic
1201983210 Y:19930438-19930460 GGCTGCATGCTCTGTGGAGCTGG + Intergenic