ID: 1002898164

View in Genome Browser
Species Human (GRCh38)
Location 6:1390875-1390897
Sequence ACCGGGCTGCTGCTGCTGTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 340}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002898164_1002898165 -9 Left 1002898164 6:1390875-1390897 CCGGACAGCAGCAGCAGCCCGGT 0: 1
1: 0
2: 1
3: 50
4: 340
Right 1002898165 6:1390889-1390911 CAGCCCGGTACCCTCGTCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 101
1002898164_1002898168 -3 Left 1002898164 6:1390875-1390897 CCGGACAGCAGCAGCAGCCCGGT 0: 1
1: 0
2: 1
3: 50
4: 340
Right 1002898168 6:1390895-1390917 GGTACCCTCGTCCCCGGCCATGG 0: 1
1: 0
2: 1
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002898164 Original CRISPR ACCGGGCTGCTGCTGCTGTC CGG (reversed) Exonic
900353161 1:2246891-2246913 GCCAGGCTGCTTCTGCTTTCTGG + Intronic
903822038 1:26110904-26110926 ACCGCGCTCCTGCCGCTCTCGGG - Intergenic
904070247 1:27790353-27790375 AGCAGGTTGCTGCTGCTGGCTGG + Intronic
904331512 1:29760918-29760940 ATCGGGCAGCTTCTGCTCTCTGG - Intergenic
904710255 1:32424974-32424996 AGCTGGCTGCTCCTGCTCTCTGG + Intergenic
905241168 1:36582493-36582515 AAGGGGCTGCTGCTTCTGCCAGG + Intergenic
905574702 1:39034497-39034519 ACAGAGCAGCTGCTGATGTCTGG + Exonic
906766323 1:48438056-48438078 AGCGGGTTGCCGCTGCTGGCTGG - Intronic
906767221 1:48444652-48444674 AGCGGGTTGCTGCTGCTGGCTGG - Intronic
906866595 1:49427768-49427790 AGCAGGTTGCTGCTGCTGGCTGG + Intronic
907198928 1:52709443-52709465 ACAGAGCAGCTGCTGATGTCTGG + Intergenic
907776331 1:57519383-57519405 ACTGTGCTGCTGCTGCTATGTGG + Intronic
908655351 1:66382645-66382667 GCCGGGGTGCTACTGCTGCCTGG + Intergenic
909604737 1:77496987-77497009 AGTGGGTTGCTGCTGCTGGCTGG - Intronic
909677917 1:78258029-78258051 ACAGGGCTGCTGCAGTTTTCTGG - Intergenic
911129171 1:94371940-94371962 AGTGGGTTGCTGCTGCTGACTGG + Intergenic
911130107 1:94378540-94378562 AGTGGGTTGCTGCTGCTGGCTGG + Intergenic
911298617 1:96147959-96147981 AGAGGGTTGCTGCTGCTGGCTGG - Intergenic
911751098 1:101499231-101499253 AACAGGTTGCTGCTGCTGGCTGG - Intergenic
913297720 1:117337779-117337801 AGCAGGTTGCTGCTGCTGGCCGG - Intergenic
913346875 1:117818365-117818387 GCCAGGGTGCTGCTGCTGCCTGG - Intergenic
914442367 1:147718656-147718678 GCCAGGGTGCTACTGCTGTCTGG + Intergenic
914831843 1:151175995-151176017 ACCGGGCTCCTCCTGCTGCTGGG - Exonic
915570609 1:156743400-156743422 ACCCTGTTCCTGCTGCTGTCTGG - Exonic
916083284 1:161250414-161250436 AGCGGGTTGCTGCTGCTGGCTGG - Intergenic
917352164 1:174089755-174089777 ACAGGGCTGCTGCGGTTTTCTGG + Intergenic
918414133 1:184289404-184289426 GCCGAGGTGCTGCTGCTGCCTGG + Intergenic
919032258 1:192257155-192257177 ACTGAGCAGCTGCTGCTGCCAGG + Intergenic
919220189 1:194618059-194618081 AGCGGGTTGCTGCTGCTGACTGG - Intergenic
919356938 1:196536492-196536514 GCTGAGCTGCTACTGCTGTCTGG - Intronic
920093434 1:203470495-203470517 TCCTGGCTGATGCTGCTGTGGGG - Intergenic
920133278 1:203749420-203749442 ATTGAGCTGCTGCTGCTGACCGG + Intergenic
920604741 1:207370943-207370965 ACTGGGTTGCCGCTGCTGGCGGG + Intergenic
921167338 1:212516574-212516596 CTCAGGCTGCTTCTGCTGTCTGG - Intergenic
921938643 1:220817406-220817428 AATGGGCTGCTGCTGCTGGCTGG + Exonic
922236210 1:223724450-223724472 ACAGGGCTAGTGCTGCTGTTTGG - Intronic
1063414644 10:5863591-5863613 AGTGGGTTGCTGCTGCTGGCAGG - Intronic
1064152466 10:12876310-12876332 ACCTGGCTGCTGAAGCTGGCGGG - Intergenic
1065082100 10:22139146-22139168 AGAGGGTTGCTGCTGCTGGCTGG - Intergenic
1067906245 10:50294418-50294440 AGCAGGGAGCTGCTGCTGTCTGG + Intergenic
1069526384 10:69175691-69175713 AGCGGGTTGCTGCTGCTGGCTGG - Intergenic
1069743293 10:70699140-70699162 CCAGGCCTGCTTCTGCTGTCAGG - Intronic
1070934682 10:80284002-80284024 ACCGGCATGGTGCTGCTGTGTGG - Exonic
1073802315 10:107055640-107055662 AAATGGCTGTTGCTGCTGTCTGG - Intronic
1074149350 10:110744372-110744394 ACCGGGCTGATGCTTGTGGCTGG + Intronic
1074953947 10:118369117-118369139 AGAAGGCCGCTGCTGCTGTCTGG + Intergenic
1075442560 10:122491576-122491598 ACCGTGCGGCTGCTTCTGGCCGG + Intronic
1076474218 10:130741164-130741186 GCCCGGCGTCTGCTGCTGTCTGG - Intergenic
1076673871 10:132137687-132137709 ACCAGGGTCCTGCTGCTCTCCGG - Intronic
1076739793 10:132477541-132477563 CCCGGGCTGCACCTGTTGTCTGG - Intergenic
1077120004 11:902826-902848 CCGGAGCTGCTGCTGCTGTGAGG - Intronic
1077466811 11:2737284-2737306 CCCGGGCAGCTGCTGCCGTGTGG + Intronic
1077762382 11:5116337-5116359 ACAGGGCTGCTGCAGTTTTCTGG + Intergenic
1078022307 11:7666024-7666046 TCTGGGCTGCAGCAGCTGTCTGG + Intronic
1079041400 11:17063578-17063600 ACCAGGCTTCTGCTGCCCTCTGG + Intergenic
1079100531 11:17538841-17538863 CCAAGGCTGCAGCTGCTGTCTGG + Intronic
1079241905 11:18727502-18727524 ACTGGGCTGCAGCTGCTGTTGGG + Intergenic
1079469795 11:20767290-20767312 AGTGGGTTGCTGCTGCTGGCTGG + Intronic
1079913372 11:26338518-26338540 AGTGGGTTGCTGCTGCTGGCTGG - Intronic
1080331983 11:31149491-31149513 GGCGGGTTGCTGCTGCTGGCTGG - Intronic
1080543765 11:33295582-33295604 AAGGAGCTGCTGCAGCTGTCGGG - Intronic
1083025907 11:59550511-59550533 ACCGGGCTGATGCAGCAGGCGGG + Intergenic
1083588733 11:63879615-63879637 ACTGGGCTGCTCCTGCTGAAGGG - Intronic
1084181064 11:67446271-67446293 ACCAGTCTCCTGCTGCCGTCTGG - Intergenic
1084425801 11:69084023-69084045 CCCAGGCTGCTGCTGGTGGCGGG + Intronic
1084690017 11:70719656-70719678 AGGGGGCTGCTGCTGCTCACTGG + Intronic
1084691762 11:70731664-70731686 TCTGGGCTGCTTCTGCTTTCTGG + Intronic
1085765412 11:79277669-79277691 ACTGGGGGCCTGCTGCTGTCAGG + Intronic
1087459318 11:98424852-98424874 AGCAGGTTGCTGCTGCTGGCTGG + Intergenic
1088085906 11:105979878-105979900 ACGTTGCTGCTGCTGATGTCCGG - Exonic
1089637566 11:119825365-119825387 AACGGGCTGCTATTCCTGTCAGG - Intergenic
1091300188 11:134502566-134502588 CCCGGGCTTCTGCTGGTGCCGGG + Intergenic
1091574103 12:1715946-1715968 ACCAGGTTGCCGCTGCTGGCTGG - Intronic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1091933519 12:4416468-4416490 AGCGGGTTACTGCTGCTGGCTGG + Intergenic
1092596317 12:10009139-10009161 AGCGGGTTGCTGCTGCTGGCTGG - Intronic
1092980834 12:13792719-13792741 GCATGGCTGCTGCTTCTGTCAGG - Intronic
1093413567 12:18895489-18895511 ACAGGGCTGCTGCAGCTTGCTGG + Intergenic
1093970348 12:25370197-25370219 AGCGGGTTGCTACTGCTGGCTGG - Intergenic
1094041832 12:26126622-26126644 CCCGGGCTGCTCCTGGAGTCGGG - Intronic
1094254923 12:28412673-28412695 AGCAGGTTGCTGCTGCTGGCTGG + Intronic
1094319350 12:29168829-29168851 AGTGGGTTGCTGCTGCTGGCTGG + Intronic
1097130968 12:56810462-56810484 TCCCTGCTGCTGCTGCTGACTGG - Intergenic
1097176990 12:57149077-57149099 AACTGGCTGCTGCTGCTGGAAGG + Intronic
1097573413 12:61359860-61359882 AGCAGGTTGCTGCTGCTGGCAGG - Intergenic
1099414399 12:82369670-82369692 AGCGGGTTGCTGCTGTTGGCTGG + Intronic
1099415059 12:82374306-82374328 AGCAGGTTGCTGCTGCTGGCTGG + Intronic
1099797822 12:87421242-87421264 AGCAGGTTGCTGCTGCTGGCTGG + Intergenic
1100529184 12:95448543-95448565 AGCGGGTTGCTGCTACTGGCTGG + Intergenic
1100530611 12:95458010-95458032 AGCGGGTTGCTGCTGCTGGCTGG + Intergenic
1101593225 12:106140401-106140423 AGCGGGCTGTTGCTGGAGTCCGG - Intergenic
1101753357 12:107601551-107601573 ACTGGGCTGCTGCTGCTGCTTGG - Intronic
1102477007 12:113195276-113195298 TCCGGGCTGCAGCTGGGGTCTGG + Intergenic
1102562109 12:113769601-113769623 ACAGGGCTGGTGCTGGTGTTGGG + Intergenic
1103049722 12:117768603-117768625 GCTGGGCTCCTGCTGCTGCCGGG - Intronic
1103626884 12:122226461-122226483 ATCGGGGCGCTGCTGCTGGCCGG - Exonic
1103721041 12:122975628-122975650 TCCGGGCTGGTGTTGCTGTGAGG - Intronic
1103940839 12:124500391-124500413 ACTTGGCTTCTGCTGCTGCCTGG - Intronic
1104794529 12:131508041-131508063 AGAGGGCTGCTGGTGCTGGCTGG - Intergenic
1104968427 12:132520306-132520328 CCCTGGCTGCTCCTGCTGTCTGG + Intronic
1105611021 13:21969850-21969872 GCCGGGCTGCTGCTGCAGGAAGG + Intergenic
1106034545 13:26031854-26031876 AGCGGGTTGCTGCTGCTGGCTGG + Intergenic
1106471085 13:30054874-30054896 AGCGGGTTGCTGCTGCTGGCTGG - Intergenic
1106938791 13:34753505-34753527 AGCGGGTTGCTGCTGCTGGCTGG - Intergenic
1107398240 13:40041184-40041206 AGCGGGTTGCTACTGCTGGCTGG - Intergenic
1107840861 13:44456251-44456273 AGCGGGTTGCTGCTGCTGGCTGG + Intronic
1108149735 13:47521118-47521140 AGCAGGCTGCCGCTGCTGGCTGG + Intergenic
1109424015 13:62149249-62149271 AGTGGGTTGCTGCTGCTGGCTGG - Intergenic
1110079239 13:71290065-71290087 AGCGGGTTGCTGCTGCTGGCTGG + Intergenic
1112505164 13:99970903-99970925 GCCGGGCCGCCGCTGCCGTCCGG + Exonic
1114209574 14:20603544-20603566 GCCGGGGTGCTACTGCTGCCTGG + Intronic
1114772161 14:25440362-25440384 AGCGGGTTGCCGCTGCTGGCTGG + Intergenic
1117377624 14:55129960-55129982 GCCGGGCTGCAGCCGCTGTCTGG + Intronic
1119266612 14:73266497-73266519 ATCAGGCTGCAGCTGGTGTCTGG - Exonic
1119509329 14:75198723-75198745 ACATGGCGGCTGCTGCTGTGAGG + Intergenic
1120103773 14:80472179-80472201 AGTGGGCTGCTGCTGCAGGCTGG + Intergenic
1121017160 14:90555889-90555911 ACCTGGGTGCTGCTGCTGGTAGG + Intronic
1121072220 14:91034644-91034666 AGCAGGTTGCTGCTGCTGGCTGG - Intronic
1121591349 14:95114116-95114138 ACCGGTGTGTTGCTGCTGCCAGG - Intronic
1121896769 14:97655974-97655996 ACCTTTCTGCAGCTGCTGTCAGG - Intergenic
1122865410 14:104601791-104601813 TCCGGGCAGCTCCTGCTGTCAGG - Intronic
1122962540 14:105102594-105102616 AGCGGGAAGCTGCTGCTGTGGGG + Intergenic
1122999409 14:105284421-105284443 TCCTGGCTGCTGCTGCCGACGGG - Intronic
1124702019 15:31923414-31923436 AGCGCGTTGCTGCTGCTGGCTGG - Intergenic
1124920227 15:34018677-34018699 AGTGGGTTGCTGCTGCTGGCTGG + Intronic
1125112326 15:36047563-36047585 AGCGGGTTGCTACTGCTGGCTGG - Intergenic
1126676529 15:51163593-51163615 ACAGGGTGGCTGCTGCTATCTGG - Intergenic
1126734875 15:51720939-51720961 AACAGGTTGCTGCTGCTGGCTGG - Exonic
1127475859 15:59332521-59332543 TGTGGACTGCTGCTGCTGTCAGG - Intronic
1127982674 15:64046227-64046249 ACCCGGGCGCTGCTGCCGTCAGG + Intronic
1128139302 15:65287167-65287189 CCAGGGCTGCTGCTGCTGTGAGG - Intronic
1128596845 15:68959920-68959942 AGCCGGTTGCTGCTGCTGGCTGG - Intronic
1131692001 15:94837314-94837336 ACCCAGTTGCTGCTGCTGGCTGG + Intergenic
1131719167 15:95148462-95148484 AGTGGGTTGCTGCTGCTGGCTGG + Intergenic
1131738356 15:95358982-95359004 AGCAGGTTGCTGCTGCTGGCTGG - Intergenic
1132566635 16:626434-626456 CCGGGGCTGGTCCTGCTGTCAGG + Intronic
1133885709 16:9825775-9825797 ACTGTGCTGCTGCTGCTGAGTGG - Intronic
1135077578 16:19407388-19407410 AGCGGGGAGCTGCTGCTTTCTGG + Intergenic
1137959584 16:52868823-52868845 AGCGGGTTGCTGCTGTTGACTGG - Intergenic
1138954020 16:61949436-61949458 AGCAGGTTGCTGCTGCTGGCTGG - Intronic
1139652893 16:68371463-68371485 TCCGGGCTGCTGCTGTCGACAGG + Exonic
1140048792 16:71461702-71461724 GCCGGGCTGCTTCTGCTGCCGGG + Exonic
1142133418 16:88441175-88441197 CCCGGGCTGCTTCTGATGTGGGG - Intergenic
1142179929 16:88663426-88663448 ACCTGTCTGCTGGTGCTGTGCGG + Intergenic
1142328484 16:89434139-89434161 ACTGGGGTGCTGCTGCCGTATGG - Intronic
1144585935 17:16487806-16487828 TCCTGGTTCCTGCTGCTGTCTGG - Intronic
1145805056 17:27720756-27720778 AGTGGGTTGCTGCTGCTGGCTGG - Intergenic
1146811433 17:35906984-35907006 ACCTGGCTGCTCCTGCTCACTGG + Intergenic
1146811485 17:35907350-35907372 AGCTGGCTGCTCCTGCTGACTGG + Intergenic
1146812032 17:35911509-35911531 AGCTGGCTGCTGCTGCTTACTGG + Intergenic
1147340563 17:39751159-39751181 AATGGGCTGCTGCTGGTCTCAGG - Intergenic
1148232961 17:45948597-45948619 ACAGGTCTGCTGCTGGTGCCAGG + Intronic
1148400608 17:47356895-47356917 GCCTTGCTGCAGCTGCTGTCGGG + Intronic
1149074674 17:52580988-52581010 AGCAGGTTGCTGCTGCTGGCTGG - Intergenic
1149213976 17:54332689-54332711 AGCAGGTTGCTGCTGCTGGCTGG - Intergenic
1149640329 17:58198782-58198804 ACAGGGCAGCTGCTGGTCTCAGG - Intronic
1149964877 17:61152193-61152215 AGCAGGTTGCTGCTGCTGGCTGG + Intronic
1151755836 17:76074839-76074861 CCCGGGCTCCTGCAGCCGTCTGG - Exonic
1152132963 17:78488317-78488339 GGAGGGCTGCTCCTGCTGTCTGG + Intronic
1152270121 17:79319609-79319631 TCCGGGCTGCTGGTCTTGTCTGG + Intronic
1152270147 17:79319746-79319768 TCTGGGCTGCTGGTCCTGTCTGG + Intronic
1152270168 17:79319855-79319877 CCTGGGCTGCTGGTCCTGTCTGG + Intronic
1152270193 17:79319983-79320005 CCTGGGCTGCTGGTCCTGTCTGG + Intronic
1152568564 17:81111291-81111313 CCCGGGCTGCAGCTGCTTGCCGG - Intronic
1153438436 18:5090770-5090792 AGCGGGTTGCAGCTGCTGGCTGG - Intergenic
1153575055 18:6511812-6511834 TCAGGGCTGCTGCTGCTTGCTGG + Intronic
1153967070 18:10191667-10191689 ACTGGGTTGCTGCTGCTGGCTGG + Intergenic
1153976315 18:10271339-10271361 GAGGGGCTGCTGCTGCTGCCTGG + Intergenic
1154080194 18:11248596-11248618 AGCAGGTTGCTGCTGCTGGCTGG - Intergenic
1155007217 18:21740576-21740598 CCCGGGCTGCTGGAGCTGTGCGG - Intronic
1155299502 18:24416485-24416507 TCGGGGCTGCTTCTGGTGTCGGG + Intergenic
1155475334 18:26231856-26231878 AGCGGGTTGTTGCTGCTGGCTGG + Intronic
1155477062 18:26245441-26245463 AGTGGGTTGCTGCTGCTGGCTGG + Intronic
1157977687 18:52343968-52343990 AGAGGGCAGCTGCTGCTGTGTGG - Intronic
1158667481 18:59445888-59445910 AGGGGGCGGCTGCTGCTTTCTGG - Intronic
1159227954 18:65564963-65564985 AGCGGGTTGCTGCTGCTGGCTGG + Intergenic
1160003262 18:75048152-75048174 ACAGGCCTGGTGCTGCTGACAGG - Intronic
1160233562 18:77067670-77067692 ACCGGGAGGCTGCTTCTCTCGGG + Intronic
1160846054 19:1166451-1166473 ACGCGGCTTCTGCTGCTGTGAGG + Intronic
1161304034 19:3557210-3557232 GCGGGGCTGCTGCTGCTGCTGGG - Exonic
1161598537 19:5165579-5165601 AGCGGGTTGCTGCTGCTGGCTGG + Intronic
1163235301 19:16026214-16026236 CCCGGGCTGCTGCTGCTTGCTGG - Intergenic
1163314940 19:16535406-16535428 ACAGGGGAGCTGCTGGTGTCTGG + Intronic
1163623151 19:18372754-18372776 ACCAGGCTCCTCCTGCAGTCTGG + Intergenic
1164510837 19:28895908-28895930 ACCGGGCTCCTATTGCTGCCAGG - Intergenic
1164936984 19:32222865-32222887 GCCAGGATGCTGCTGCTGCCGGG - Intergenic
1165752200 19:38267132-38267154 ACCTGACTGCTGCTGCCGACTGG + Intronic
1167097528 19:47382307-47382329 ACAAGGCAGCTGCTGCTTTCTGG - Exonic
1167663404 19:50809972-50809994 ACAGAGCTGCTGCTGCTGATGGG + Intergenic
924980442 2:214566-214588 ACCGGGCTGCTTCTGCCAACAGG + Intergenic
925070897 2:965642-965664 CGGGGGCTGCTGCTGCTGGCGGG + Intronic
927955922 2:27207326-27207348 CCTGGGCTGCTGCTACTTTCTGG - Exonic
928106692 2:28475110-28475132 AGTGGGTTGCTGCTGCTGGCTGG + Intronic
928733741 2:34261715-34261737 ATCTTGCTGCGGCTGCTGTCAGG - Intergenic
929926665 2:46217919-46217941 ACCATGCTGCTGCTGCTGCCAGG + Intergenic
930124128 2:47783151-47783173 ACCGCGCGGCTCCTGCTGGCGGG - Exonic
931441281 2:62292598-62292620 ACGGGGCTGCTGCTGTGGTGGGG - Intergenic
931470708 2:62535635-62535657 AGTGGGTTGCTGCTGCTGGCTGG + Intergenic
931835317 2:66092886-66092908 ATCTTGCTGCTGCTGCTGACAGG + Intergenic
932425920 2:71635079-71635101 TCCGGGTGGCTGCTGCTGCCTGG + Intronic
932756818 2:74415115-74415137 CCCGGCCCGCTGCTGCTGGCAGG + Exonic
934746282 2:96761567-96761589 ACGGTGCTGCTGGTGCTGTCGGG + Exonic
936249391 2:110855905-110855927 AGCGGGTTGCCGCTGCTGGCTGG + Intronic
937050437 2:118883926-118883948 AGCAGGTTGCTGCTGCTGGCTGG + Intergenic
937210869 2:120269413-120269435 AGCAGGTTGCTGCTGCTGGCTGG + Intronic
937379384 2:121362855-121362877 AAGGGTCTGCTGCTGCTTTCTGG - Intronic
937684123 2:124677422-124677444 AGCAGGTTGCTGCTGCTGGCTGG + Intronic
938483744 2:131682513-131682535 ACCACGCTGCTGCTGCTGCAGGG - Intergenic
939057589 2:137382890-137382912 GCCAGGATGCTGCTGCTGCCTGG + Intronic
940362727 2:152813450-152813472 TCCTGACTGCTGCTGCTGCCAGG - Intergenic
943899352 2:193412371-193412393 AGCGGGTTGCCGCTGCTGGCTGG + Intergenic
944545678 2:200796863-200796885 ATCAGGCTGCTGCTGATGTTGGG - Intergenic
945056571 2:205874477-205874499 ACCTGGCTGCCGCTGCTGGTAGG + Intergenic
945825745 2:214717803-214717825 AGCGGGTTGCTGCTGCTGGCTGG + Intergenic
946019900 2:216633766-216633788 GCCGGGCTGCGGCTGCTGCTCGG + Exonic
946939214 2:224753678-224753700 AGCGGGTTGCTGCTGCTGGCTGG + Intergenic
947209950 2:227699416-227699438 ACCTGGCTGCTGCTGTTGTTTGG - Exonic
948864273 2:240767539-240767561 ACCGGCCTGCTGCTGTTGGTGGG - Intronic
948992893 2:241563729-241563751 GCCTGGCTCCTGCTGCTGTCAGG - Intronic
1170150523 20:13221792-13221814 GCCGAGCTGCTGCTGCTGCTGGG + Exonic
1171037629 20:21728804-21728826 CACGGGTTGCTGCTGCTGGCTGG - Intergenic
1171123043 20:22582186-22582208 CGCGGCCTGCTGCTGCTGCCCGG + Exonic
1171446306 20:25207068-25207090 ACCGTGCTGCGGCTGCTGGTGGG - Exonic
1173950586 20:46990078-46990100 ACCGTGCTGACGCTGCTGTGTGG + Exonic
1174095200 20:48083248-48083270 AGCGGGTTGCCGCTGCTGGCTGG - Intergenic
1175645528 20:60667465-60667487 ACAGGGTTGCTGCTCCTCTCGGG - Intergenic
1175658208 20:60790308-60790330 ACTGGGTGGCTGCTGCTGGCTGG + Intergenic
1177134764 21:17297155-17297177 AGTGGGTTGCTGCTGCTGGCTGG - Intergenic
1177691182 21:24509715-24509737 AATGGGTTGCTGCTGCTGCCTGG - Intergenic
1178061433 21:28857052-28857074 AGCCTGCTGCTGCTGCTGGCTGG - Intergenic
1179129538 21:38622237-38622259 ACAGGGCCCCTGCTGCTTTCCGG + Intronic
1179644690 21:42768122-42768144 ACGGGCCTGCTGCTGCTGCTCGG - Intronic
1180707106 22:17816818-17816840 AGAGGGCTGCGCCTGCTGTCTGG - Intronic
1181456378 22:23062325-23062347 GCCCGGCAGCTGCTGCTGTTGGG - Intronic
1181761617 22:25062646-25062668 ACTGGGCTGCTGCTTCTTGCTGG + Intronic
1182524289 22:30906042-30906064 TCCGAGCTGCAGCTGCTGCCCGG - Exonic
1182642970 22:31783220-31783242 CCTGGGCTGCCGCTGCTGGCTGG - Intronic
1184029144 22:41880996-41881018 AGGGGGCAGCTGCTGCTGCCTGG + Intronic
1184690067 22:46113526-46113548 AAGGGGCAGCTGCTGCTGGCTGG - Intronic
1184996539 22:48211199-48211221 CTCGGGCTGCAGCTGCTGTGAGG + Intergenic
1185326766 22:50229504-50229526 AGCAGGCTGCTGATGCTCTCGGG + Exonic
949790837 3:7790452-7790474 AGCGGGTTGCTGCTGCTGGCTGG + Intergenic
950238781 3:11348687-11348709 AGTGGGTTGCTGCTGCTGGCTGG + Intronic
950270062 3:11606798-11606820 AGTGGGTTGCTGCTGCTGGCTGG - Intronic
952940254 3:38438732-38438754 AGTGGGTTGCTGCTGCTGGCTGG + Intergenic
952941280 3:38446114-38446136 AGTGGGTTGCTGCTGCTGGCTGG + Intergenic
953084845 3:39655879-39655901 ACGGGGCAGCTGCTGCTGGGTGG - Intergenic
959564301 3:107818729-107818751 AGCGGGTTGCTGCTGCTGGCTGG - Intergenic
960064116 3:113352292-113352314 AGCAGGTTGCTGCTGCTGGCTGG - Intronic
961233632 3:125343689-125343711 AGCGGATTGCTGCTGCTGGCTGG - Intronic
961612552 3:128152833-128152855 AGAGGGTTGCTGCTGCTGGCGGG + Intronic
962289585 3:134122944-134122966 ACCCCACTGCTGCTGCTGTTGGG - Intronic
963477717 3:145828388-145828410 ACAGGGCTGCTGCAGTTTTCTGG + Intergenic
963692785 3:148525659-148525681 AGCGGGTTGCTGCTGCTGGCTGG - Intergenic
967108680 3:186273827-186273849 ACCGGGGAGCTGCTGCTGCAGGG - Intronic
967572025 3:191040939-191040961 ACCAAGCTGCTGCTGCTGGAGGG + Intergenic
967866639 3:194195408-194195430 CCAGTGCTGCTGCTGCTGACAGG - Intergenic
968488228 4:875412-875434 AGCTGGCGCCTGCTGCTGTCAGG - Intronic
968754520 4:2408495-2408517 CCCCGGCTGGTGCAGCTGTCAGG - Intronic
969170906 4:5362572-5362594 ACCTGGCTGCTGCTAATCTCAGG - Intronic
971563028 4:28105746-28105768 ATGGGGGTGCTACTGCTGTCTGG - Intergenic
972035441 4:34514058-34514080 AGCAGGTTGCTGCTGCTGGCTGG - Intergenic
974124265 4:57676444-57676466 ACCAGGTTGCCGCTGCTGGCTGG - Intergenic
975202379 4:71607048-71607070 AGCGGGTTGCTGCTGCTGGCTGG + Intergenic
976173978 4:82334033-82334055 AGTGGGTTGCTGCTGCTGGCTGG + Intergenic
976174693 4:82338991-82339013 AGAGGGTTGCTGCTGCTGGCTGG + Intergenic
976274028 4:83258063-83258085 AGCGGGCTCCTGCTGCCTTCTGG - Intergenic
976348098 4:84028507-84028529 AAAGGGCTCCTTCTGCTGTCTGG - Intergenic
976811822 4:89107230-89107252 ACTGGGGTGCTACTGCTGCCTGG + Intronic
977162945 4:93659032-93659054 ACAGGGCTGCTGCTGCTACTGGG - Intronic
980087186 4:128403570-128403592 ATCTTGCTGCTGCTGCTGTTGGG + Intergenic
982424146 4:155237065-155237087 AGCGGGTTGCCGCTGCTGGCTGG + Intergenic
982893493 4:160886116-160886138 AACAGGTTGCTGCTGCTGGCTGG + Intergenic
984238682 4:177192736-177192758 AGCGGGTTGCCGCTGCTGGCTGG + Intergenic
984340816 4:178453879-178453901 AGCGGGTTGCAGCTGCTGACAGG + Intergenic
985682996 5:1266176-1266198 ACCTGGCTCCTGCTGCTCTTTGG - Intronic
986929182 5:12796528-12796550 GATGGGTTGCTGCTGCTGTCTGG - Intergenic
988458807 5:31413619-31413641 AACGTGCTGCTGCTGCCCTCAGG + Intronic
988619135 5:32804565-32804587 AGTGGGTTGCTGCTGCTGGCTGG + Intergenic
989024928 5:37056287-37056309 ATCTTGCTGCTGCTGCTGTTGGG + Intronic
989760268 5:45007384-45007406 AGCAGGTTGCTGCTGCTGGCTGG - Intergenic
992545423 5:77810282-77810304 AGTGGGTTGCTGCTGCTGGCTGG - Intronic
994425002 5:99574100-99574122 ACTGCCCTGCTGATGCTGTCCGG - Intergenic
995928581 5:117407356-117407378 AGTGGGTTGCTGCTGCTGGCTGG + Intergenic
997462015 5:134059195-134059217 CCCAGTCTGCTGCTCCTGTCTGG - Intergenic
999694135 5:154173236-154173258 TCCCGGACGCTGCTGCTGTCAGG + Intronic
1000535465 5:162472832-162472854 AGCGGGTTGCTGCTGCTGGCTGG - Intergenic
1000651455 5:163822872-163822894 ACCATGCTGCTGTTGCTGCCAGG + Intergenic
1001532973 5:172477704-172477726 CCCGGAATTCTGCTGCTGTCTGG + Intergenic
1002898164 6:1390875-1390897 ACCGGGCTGCTGCTGCTGTCCGG - Exonic
1002927154 6:1611223-1611245 AGGCTGCTGCTGCTGCTGTCGGG - Exonic
1003145233 6:3504846-3504868 AGCGGGTTGCCGCTGCTGGCTGG + Intergenic
1003329804 6:5120559-5120581 AGTGGGTTGCTGCTGCTGGCTGG + Intronic
1005279526 6:24258249-24258271 AGTGGGTTGCTGCTGCTGGCTGG + Intronic
1005763135 6:28986097-28986119 ATCAGGCAGCTGCAGCTGTCAGG + Intergenic
1005821893 6:29605657-29605679 AAGGGGCTGCTGCTGCTGCTGGG - Exonic
1005847332 6:29792254-29792276 ACCCTGCTTCTGCTGCTCTCGGG + Intergenic
1007406034 6:41637042-41637064 GCCGGGATCCGGCTGCTGTCCGG - Intronic
1008649512 6:53548336-53548358 TCTGGGCTGCTGCTGCTGCTAGG + Intronic
1009385026 6:63077684-63077706 ACCAGGTTGCCGCTGCTGGCTGG + Intergenic
1012789621 6:103676819-103676841 AGTGGGTTGCTGCTGCTGGCTGG + Intergenic
1013836570 6:114342268-114342290 ACCCGGCCGCTGCTGCGGTCCGG + Exonic
1013960212 6:115889876-115889898 ACCGGGTTGCCACTGCTGGCTGG - Intergenic
1013977065 6:116091358-116091380 AGCAGGCTGCCGCTGCTGGCTGG - Intergenic
1015032589 6:128613655-128613677 AGCGGGTTGCCGCTGCTGGCTGG + Intergenic
1016340678 6:143059200-143059222 AGCGGGTTGCTGCTGCTGGCTGG - Intergenic
1017025561 6:150177810-150177832 ACTGGGGTTCTGCTGCAGTCCGG - Intronic
1017950458 6:159131127-159131149 ACAGGTCAGATGCTGCTGTCTGG + Intergenic
1018366719 6:163128376-163128398 CCAGGGCCGCTGCTGCAGTCTGG + Intronic
1019079636 6:169421606-169421628 GCAGGGCTTCTGCTGCTGCCTGG - Intergenic
1019138247 6:169925654-169925676 ACCCTTCAGCTGCTGCTGTCTGG + Intergenic
1019518834 7:1451559-1451581 ACATGGCAGCAGCTGCTGTCCGG - Intronic
1019982099 7:4629353-4629375 AGCAAGCTGCTGCTGCTGCCAGG + Intergenic
1021347878 7:19549592-19549614 AGGGGGTTGCTGCTGCTGACTGG + Intergenic
1022096994 7:27147391-27147413 CCCTGCCCGCTGCTGCTGTCGGG + Exonic
1022103783 7:27184477-27184499 TCGGGGCTGCTGCTGCTCTCGGG + Exonic
1022363332 7:29684910-29684932 TACGGGCCGCTGCTGCTGTTCGG + Intergenic
1022427992 7:30285667-30285689 TACGGGCCGCTGCTGCTGTTCGG - Exonic
1023663303 7:42493437-42493459 ATCCGGCTGCTCCTGCTGTCAGG - Intergenic
1024285302 7:47751996-47752018 GGTGGGCTGCTGCTGCTGGCTGG - Intronic
1024443235 7:49446099-49446121 AGCGGGTTGCTGCTACTGGCTGG - Intergenic
1024945524 7:54804002-54804024 AGCAGGTTGCTGCTGCTGGCTGG - Intergenic
1026461184 7:70616449-70616471 ACGGGGCTGATGCAGCTGCCCGG + Intronic
1026549769 7:71358013-71358035 AGCGGGTTGCCGCTGCTGGCTGG - Intronic
1027916601 7:84331685-84331707 ATGTGGCTGCTGCTGCTGTTTGG + Intronic
1029467780 7:100736949-100736971 CTCAGGCTGCTGCTGCTCTCGGG + Exonic
1030115473 7:106059266-106059288 ACAGGGATGCTGCTGTTGTTTGG - Intergenic
1031349350 7:120709989-120710011 AATGGTCTGCTGTTGCTGTCTGG - Intronic
1032096824 7:128942386-128942408 ACCATGCTGCTGCTGATGCCGGG + Intronic
1032187754 7:129741876-129741898 GCCAGGCTGCTGCTGCTGTTGGG - Intronic
1032440668 7:131940783-131940805 ACCTGGCTGCTGCTTCTTTCCGG + Intergenic
1032927860 7:136629546-136629568 AGTGGGTTGCTGCTGCTGGCTGG - Intergenic
1033936982 7:146598167-146598189 AATGGGCTGTTTCTGCTGTCTGG + Intronic
1034293229 7:149948629-149948651 CCCGGGCAGTTGCTGGTGTCAGG + Intergenic
1035522184 8:284006-284028 CCACGGCTGCTGCTGCTGCCTGG - Intergenic
1036149599 8:6285309-6285331 AACGCCCTGCTGCTGCTGTCAGG - Intergenic
1039276584 8:35939161-35939183 AGCAGGTTGCTGCTGCTGGCTGG - Intergenic
1040667268 8:49649887-49649909 AGCAGGTTGCTGCTGCTGGCTGG + Intergenic
1041172185 8:55155226-55155248 ACACAGCTGCTGCAGCTGTCTGG - Intronic
1041818717 8:62004213-62004235 AGCGGGTTGCTGCTGCAGGCTGG + Intergenic
1041869369 8:62615820-62615842 ACCACACTGCTGCTGCTGCCAGG + Intronic
1042771567 8:72388293-72388315 AGTGGGTTGCTGCTGCTGGCTGG - Intergenic
1042772574 8:72395368-72395390 AGCAGGTTGCTGCTGCTGTCTGG - Intergenic
1044302836 8:90606056-90606078 ACCGGGTTGCAGCTGTTGACTGG + Intergenic
1044441800 8:92231861-92231883 ACCGGGTTGCCACTGCTGGCTGG - Intergenic
1044534768 8:93345900-93345922 AGCGGGTTGCCGCTGCTGGCTGG - Intergenic
1045858205 8:106788926-106788948 AGCGGGTTGCTGCTGCTGGCTGG - Intergenic
1048274892 8:133058681-133058703 GCTGAGCTGCTGCTGCTGTCAGG - Intronic
1049188083 8:141269914-141269936 ACTGGGCTGCCTCTGCTGTGGGG - Intronic
1049238609 8:141525296-141525318 ATGGGGCTGCTGGGGCTGTCTGG + Intergenic
1049299793 8:141863439-141863461 GCCCAGCTGCTGCTGCTCTCAGG - Intergenic
1049643658 8:143726681-143726703 ACCGGACTGCTCCTGCGCTCCGG + Exonic
1050204251 9:3180936-3180958 GCCGGGCTGCCTCTCCTGTCCGG - Intergenic
1050923951 9:11240317-11240339 AGAGGGTTGCTGCTGCTGGCTGG + Intergenic
1051680368 9:19601375-19601397 AGTGGGTTGCTGCTGCTGGCTGG - Intronic
1053638666 9:40043827-40043849 AGCAGGTTGCTGCTGCTGGCTGG + Intergenic
1053767419 9:41421362-41421384 AGCAGGTTGCTGCTGCTGGCTGG - Intergenic
1054319459 9:63640372-63640394 AGCAGGTTGCTGCTGCTGGCTGG + Intergenic
1054546084 9:66332881-66332903 AGCAGGTTGCTGCTGCTGGCTGG - Intergenic
1055951149 9:81730892-81730914 AGTGGGTTGCTGCTGCTGGCTGG - Intergenic
1055990309 9:82098939-82098961 AGCGGGTTGCCGCTGCTGGCTGG - Intergenic
1057440914 9:95082621-95082643 ACGGGCGAGCTGCTGCTGTCTGG - Exonic
1058403287 9:104641687-104641709 AGCGGGTTGCCGCTGCTGGCTGG - Intergenic
1059544577 9:115163603-115163625 ACTGGGCTCCTGCTACTCTCAGG - Intronic
1061429844 9:130523999-130524021 TCAGGGCTGCGGCTGCTGCCTGG - Intergenic
1061621218 9:131812480-131812502 TCCGGGCAGCTGCTGCTTTGGGG - Intergenic
1062028129 9:134349928-134349950 TCCTGGCTGCAGCTGGTGTCTGG + Intronic
1203772683 EBV:57646-57668 TGGGGGCTGCTGCTGCAGTCGGG + Intergenic
1187010502 X:15273692-15273714 AGCAGGTTGCTGCTGCTGGCTGG - Intergenic
1188097361 X:26041660-26041682 AGCGGGTTGCTGCTGCTGTCTGG - Intergenic
1188506386 X:30889112-30889134 ACCAGGCGGCTGCTGCTCTCTGG + Intronic
1190133159 X:47769213-47769235 ACAGGGCTGCTGCAGTTTTCCGG - Intergenic
1191206298 X:57836736-57836758 AGCGGGTTGCTGCTGCTGGCTGG + Intergenic
1192027453 X:67469284-67469306 AGCTGGTTGCTGCTGCTGGCTGG + Intergenic
1192204983 X:69089614-69089636 TCCAGGCTGCTGCTGCTTCCTGG - Intergenic
1192484576 X:71513989-71514011 AGCGGGTTGCTGCTGCTGGCTGG - Intronic
1193919433 X:87407155-87407177 ACCTGGCTGCTGCTGTTGGGAGG + Intergenic
1194920314 X:99757841-99757863 ACCGTGCTGCCACTGCTGCCAGG - Intergenic
1195552749 X:106186749-106186771 AGCGGGTTGCTGCTGCTGGCTGG + Intronic
1195579955 X:106490208-106490230 AGTGGGTTGCTGCTGCTGGCTGG + Intergenic
1196108320 X:111919332-111919354 AGCGGGTTGCCGCTGCTGGCTGG - Intronic
1196312904 X:114189223-114189245 AGCGGGTTGCTGCTGCTGGCTGG - Intergenic
1200118831 X:153781035-153781057 CCCGGGCGGCTGCTCCTGTGGGG - Exonic
1200945276 Y:8829642-8829664 AGTGGGTTGCTGCTGCTGGCTGG - Intergenic
1201321565 Y:12703688-12703710 AGCAGGTTGCTGCTGCTGGCTGG + Intronic
1201406661 Y:13657020-13657042 AGCCGGTTGCTGCTGCTGACTGG + Intergenic
1201456032 Y:14167603-14167625 AGCAGGCTGCGGCTGCTGGCTGG - Intergenic
1201530205 Y:14983512-14983534 AGCAGGTTGCTGCTGCTGGCAGG - Intergenic
1201910795 Y:19131869-19131891 ACTGGGTTGCAGCTGCTGGCTGG - Intergenic
1201911843 Y:19140614-19140636 AGCTGGTTGCTGCTGCTGTCTGG - Intergenic
1202089543 Y:21175550-21175572 AGTGGGTTGCTGCTGCTGGCTGG + Intergenic
1202147035 Y:21808892-21808914 AGCAGGTTGCTGCTGCTGGCTGG + Intergenic