ID: 1002898812

View in Genome Browser
Species Human (GRCh38)
Location 6:1393923-1393945
Sequence GGGAGCCGCCCCGGGAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002898806_1002898812 -3 Left 1002898806 6:1393903-1393925 CCGGTGCAGGCCGGGGACCGGGG 0: 1
1: 0
2: 2
3: 23
4: 282
Right 1002898812 6:1393923-1393945 GGGAGCCGCCCCGGGAGAGCAGG 0: 1
1: 0
2: 0
3: 28
4: 280
1002898804_1002898812 -2 Left 1002898804 6:1393902-1393924 CCCGGTGCAGGCCGGGGACCGGG 0: 1
1: 0
2: 0
3: 41
4: 355
Right 1002898812 6:1393923-1393945 GGGAGCCGCCCCGGGAGAGCAGG 0: 1
1: 0
2: 0
3: 28
4: 280
1002898796_1002898812 23 Left 1002898796 6:1393877-1393899 CCGGCGGCGGGTGGAGGTCAAGC 0: 1
1: 0
2: 1
3: 4
4: 74
Right 1002898812 6:1393923-1393945 GGGAGCCGCCCCGGGAGAGCAGG 0: 1
1: 0
2: 0
3: 28
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002898812 Original CRISPR GGGAGCCGCCCCGGGAGAGC AGG Intronic
900211690 1:1459423-1459445 GGGGGCCTCCCGGGCAGAGCTGG + Intronic
900224499 1:1526723-1526745 GGGGGCCTCCCGGGCAGAGCTGG + Intronic
900419214 1:2548354-2548376 GGGGGCCGCCCTGCCAGAGCTGG - Intergenic
901016841 1:6236646-6236668 GGGAGCCGCAGAGGGAGGGCAGG - Intergenic
901056370 1:6450343-6450365 GGGAGCGGGCCAGGGAGAGCGGG - Intronic
901660141 1:10794098-10794120 GGGAGCTGTCCCGGCTGAGCAGG - Intronic
902330163 1:15727388-15727410 CGGGGCATCCCCGGGAGAGCCGG - Exonic
902477977 1:16698143-16698165 GGGAGCGGGCCAGGGAGAGCAGG + Intergenic
903724639 1:25431335-25431357 GGGGTCCGCCCCGGGTGCGCGGG + Intronic
904181297 1:28668699-28668721 GGCCGCCGCCGCCGGAGAGCTGG - Intergenic
904643087 1:31945003-31945025 GGGAGCCGCTCGGGGACTGCAGG + Intergenic
904801015 1:33093031-33093053 TGGAGCTGCCCCAGGAGAGTTGG + Intronic
905632708 1:39527509-39527531 GGGAGGGGCCTGGGGAGAGCTGG + Intergenic
907050907 1:51329653-51329675 GAGAGCCGGCCCAGGTGAGCTGG - Intronic
907901801 1:58748064-58748086 GGGAGCCGCCTGGGGAGCCCAGG + Intergenic
908572164 1:65420962-65420984 TGGTGCCGCCACTGGAGAGCAGG - Intronic
909698947 1:78499107-78499129 AGGAGCTGCCCTGGGAGATCAGG + Intronic
910277389 1:85464366-85464388 GGGTGCCGCTCCGGTAGGGCGGG - Intronic
912818720 1:112850164-112850186 GGGAGCCGGCGCTGGGGAGCCGG + Intergenic
915558005 1:156670672-156670694 GGGAGCCTCCCAGGGAGGGTAGG - Exonic
916033020 1:160894928-160894950 GGGAGCGGCCGCGGGAGACTGGG - Intergenic
917213993 1:172659257-172659279 TGGAGGGGCCCAGGGAGAGCTGG - Exonic
917536514 1:175878174-175878196 GGGAGTCCCTCTGGGAGAGCCGG + Intergenic
917966678 1:180183230-180183252 GAGGGCTGCCCCGGGGGAGCTGG - Intronic
919403259 1:197146471-197146493 CGGAGCCGCCTCGTGGGAGCGGG - Exonic
920873619 1:209814736-209814758 GGGAGCAGCCCTGGGATAGGGGG - Intergenic
922472063 1:225882759-225882781 TAGACCCGCCCCGGGAGAGTGGG + Intergenic
922814099 1:228437027-228437049 CGGAGCCGCACAGGGAGAGCAGG - Intergenic
922937018 1:229430960-229430982 GGAGGCCGCCCCGGCAGTGCTGG + Intergenic
923038311 1:230300980-230301002 TGCAGCCGCCCCGGAAAAGCTGG - Intergenic
923783022 1:237042490-237042512 GGGAGCCGGCCCCGGCGAGGAGG + Exonic
1062767469 10:76484-76506 GGGAGACGCTCCGGGACACCTGG - Intergenic
1063944792 10:11165815-11165837 GGGAGCAGCCCCTGGAGCACAGG - Intronic
1064478897 10:15720002-15720024 AGGAGGCGCCGCGAGAGAGCTGG - Exonic
1065712801 10:28533402-28533424 GGGAGATGGCCCGGGAGCGCCGG + Exonic
1069818276 10:71212417-71212439 GGGCGCGGCCGCGGCAGAGCTGG - Intergenic
1071505046 10:86227122-86227144 GGAAGCTGCCCTGGTAGAGCAGG - Intronic
1073057200 10:100710326-100710348 GGGAGGAGCCGCGGGAGGGCAGG - Intergenic
1073080163 10:100854537-100854559 GGGAGCAGCCCCTGGAAAGATGG - Intergenic
1073287744 10:102398788-102398810 GGGAGCCACCCCCGAAGGGCTGG - Exonic
1075086267 10:119416280-119416302 GGGAGCAGTGCCGGGAGAGCAGG + Intronic
1075576868 10:123584156-123584178 CGGAGCCACCCCTGGAGAACGGG - Intergenic
1076029033 10:127142199-127142221 TGGAGCCGCCCTGGGAAAGCAGG - Intronic
1076092780 10:127702775-127702797 GGGAGCCCCCTCGGCCGAGCTGG - Intergenic
1076532795 10:131155798-131155820 GGGAGCAGCCCAGGGAGTGGGGG - Intronic
1076652880 10:132002141-132002163 GGGAGCAGACATGGGAGAGCTGG - Intergenic
1076919943 10:133446201-133446223 GGAAGCTGCCCCGGGAGAGGGGG - Intergenic
1077179905 11:1207601-1207623 CTGAGACGCCCCGGGAGAGGAGG - Intergenic
1077194186 11:1271051-1271073 GGGAGCCGGCCTGGGGCAGCAGG + Intergenic
1077219317 11:1408398-1408420 GGCAGCAGCCACGGGAGAACTGG + Intronic
1077436026 11:2539641-2539663 GGGAACTGGCCTGGGAGAGCTGG - Intronic
1078600356 11:12724890-12724912 GGGAGCAGCCCCGGAAGCACAGG - Intronic
1080551377 11:33376319-33376341 AGGAGCCGGCCCGGGGGAGGGGG + Intergenic
1081831950 11:46121634-46121656 AGGAGGCGCCGGGGGAGAGCGGG + Intergenic
1081887253 11:46508440-46508462 GGGAGATGCCATGGGAGAGCTGG - Intronic
1083300510 11:61737573-61737595 GGGAGCCATCCCAGGAGTGCAGG + Intronic
1084416515 11:69035805-69035827 GGGTGAAGCCCCGGGAGAGGGGG - Intergenic
1084656638 11:70523523-70523545 GGGATCCTCCCCAGCAGAGCAGG - Intronic
1089243137 11:117098447-117098469 GGGAGCCGGCTCGGGGGAGGGGG + Intergenic
1090974132 11:131667512-131667534 GGGAGCAGCCCCATGACAGCAGG + Intronic
1094107847 12:26832845-26832867 GGGAGCCGCCGCGGCAGAAGCGG + Exonic
1096493772 12:52027336-52027358 GGCTGCCTCCCAGGGAGAGCTGG - Intronic
1096559236 12:52423997-52424019 GGGAGCAGGCCTGGGAGAGGAGG + Intergenic
1097307742 12:58087885-58087907 GGCAGGCGCCCCGGGAGCCCAGG + Intergenic
1097872401 12:64611591-64611613 AGGAGCCGCACCAGGGGAGCCGG + Intronic
1097929765 12:65170300-65170322 AGGAGCCGCTCTGGGCGAGCCGG + Exonic
1099204435 12:79711357-79711379 GGGTCCCGCACCGGGAGCGCAGG - Intergenic
1101427095 12:104597105-104597127 GAGAGCAGCCCACGGAGAGCTGG - Intronic
1101466975 12:104958522-104958544 GGGAGCCTGCCCAGGAGAGAAGG + Intronic
1102678577 12:114674657-114674679 CTGAGCGGCCCCGGGACAGCGGG - Exonic
1104051100 12:125194443-125194465 GGGAGTCACCCCAGGAGTGCCGG - Intronic
1104698058 12:130879618-130879640 GGGAAGCGCCCCTGGAGAGCAGG + Intergenic
1104947599 12:132423557-132423579 AGCAGCGGCCCCGGGAGGGCGGG + Intergenic
1105278397 13:18949298-18949320 GGGAGCCGCCCCCACAGTGCCGG + Intergenic
1105409596 13:20160890-20160912 GGTCGCCGCCGCGGCAGAGCGGG - Exonic
1106269295 13:28138500-28138522 CGGAGCCGCCCGGGGAGAAGGGG - Exonic
1108693451 13:52881216-52881238 AGGAGCCGTCCACGGAGAGCAGG + Intergenic
1112589101 13:100747707-100747729 CGCAGCAGCCCCGGCAGAGCAGG - Intergenic
1113655721 13:112067038-112067060 GGGAGGGGCCCGGGGACAGCGGG - Intergenic
1113895085 13:113759234-113759256 GGCTGTGGCCCCGGGAGAGCCGG + Exonic
1118329161 14:64802375-64802397 GGGAGCCTCCCAGGGACGGCAGG - Intronic
1121101575 14:91253583-91253605 CGGAGCGGCCCCGCGAGCGCGGG - Intronic
1121329136 14:93039099-93039121 GGCAGCACCCCCGTGAGAGCTGG - Intronic
1122209549 14:100165944-100165966 GGGAGCCTGCCTGGGAGAGTGGG + Intergenic
1122209567 14:100165990-100166012 GGGAGCCTGCCCGGGAGAGTGGG + Intergenic
1122209587 14:100166036-100166058 GGGAGCCTGCCCGGGAGAGTGGG + Intergenic
1122209606 14:100166082-100166104 GGGAGCCTGCCCGGGAGAGTGGG + Intergenic
1122772588 14:104103962-104103984 GGGAGCCGCCCCTGCTGTGCTGG + Intronic
1123676449 15:22714651-22714673 GGGAGGCGCCTCGAGGGAGCCGG + Intergenic
1124328663 15:28788911-28788933 GGGAGGCGCCTCGAGGGAGCCGG + Intergenic
1125540900 15:40469588-40469610 GAGAGCCTGCCCTGGAGAGCTGG + Intergenic
1127650316 15:61000508-61000530 GGGAGCATGCCTGGGAGAGCAGG + Intronic
1128456543 15:67834642-67834664 GGGAGCCGCCCCGCGGGTTCTGG + Intergenic
1128582401 15:68818955-68818977 GGGGGCGGCCGCGGGAGAGGAGG - Intronic
1129457293 15:75682763-75682785 GGGAGCCGGCTCGGGCCAGCTGG - Intronic
1129660392 15:77549845-77549867 GAGGGCTGCCCCTGGAGAGCAGG + Intergenic
1129726493 15:77904182-77904204 GGGAGCCGGCTCGGGCCAGCCGG + Intergenic
1131829094 15:96343047-96343069 GGGGGCCGCTCCGGGGGAGATGG - Intergenic
1132090822 15:98946774-98946796 GGGAGCCGTGCCGTGAGAACTGG + Intronic
1132381058 15:101367027-101367049 GGGAGGGGCCCGTGGAGAGCGGG + Intronic
1134024259 16:10942271-10942293 GGGAGGCGCCACGAGGGAGCCGG - Exonic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1137718599 16:50613815-50613837 GGGGGAAGCCCCGGGAGAGAAGG - Intronic
1138023145 16:53502835-53502857 GGGACCCGGCCGGGGAGGGCGGG + Intronic
1138507585 16:57485987-57486009 GGGGGCAGGCCCGGGAGCGCAGG + Intronic
1141430590 16:83968701-83968723 GGGAGCCGCCGCAGCAGGGCCGG + Exonic
1141511848 16:84517398-84517420 GGGAGGCACCCGGGAAGAGCTGG - Intronic
1141635740 16:85313002-85313024 GGCAGCCTCCCTGGGAGAGGAGG + Intergenic
1141691889 16:85601286-85601308 GGGAGCAGCCCCAGGAGAGGAGG + Intergenic
1141948504 16:87325744-87325766 GGGTGCCCTCCAGGGAGAGCAGG - Intronic
1142411200 16:89918106-89918128 GCGCGCCGCCCGGGGAGGGCGGG + Exonic
1142426933 16:90006463-90006485 GGTAGCCGGCCCGGGGCAGCGGG + Exonic
1142631716 17:1229850-1229872 CGGAGCCGCCGGGGGAGGGCGGG + Intergenic
1143852742 17:9824957-9824979 GGGAGCTGGCCTGGGAGAGGTGG + Intronic
1143894900 17:10128150-10128172 TGGAGCCGCCCCGGAACTGCTGG - Intronic
1144010677 17:11145878-11145900 GGGAGCAGCCCGGGGAGGCCTGG - Intergenic
1144380605 17:14693744-14693766 GGGGGCAGCCCCAGCAGAGCTGG + Intergenic
1144622907 17:16829906-16829928 GGGAACTGCGCTGGGAGAGCAGG + Intergenic
1144883524 17:18442810-18442832 GGGAACTGCGCTGGGAGAGCAGG - Intergenic
1145148704 17:20501576-20501598 GGGAACTGCACTGGGAGAGCAGG + Intergenic
1145243462 17:21252886-21252908 GGCAGACTTCCCGGGAGAGCAGG - Intronic
1146787457 17:35732035-35732057 CGGGGCCGCCACGTGAGAGCTGG + Intronic
1147250713 17:39151328-39151350 GGGAGCCGGCCCGGGTGGGCCGG - Intronic
1147577230 17:41609842-41609864 GGGAACTGCGCCAGGAGAGCAGG + Exonic
1148808123 17:50274381-50274403 CGGAGCTGCACCGGGAGAGGCGG - Intronic
1149430720 17:56594117-56594139 GTGAGCCGCCTCCGGAGAGACGG + Exonic
1151414583 17:73952923-73952945 GGGAGCCGGCCGGAGGGAGCCGG - Intergenic
1151439772 17:74120634-74120656 GGGAGCCCCAGCAGGAGAGCAGG + Intergenic
1151509168 17:74547719-74547741 GGTGGCCGCCCCTTGAGAGCAGG + Intergenic
1151566914 17:74903789-74903811 GGGAGGCGCCCAGGGACAGAGGG + Intergenic
1151662282 17:75525381-75525403 GGGAGGCGGCCCGGGACCGCAGG + Intronic
1152111688 17:78360449-78360471 GGGCGCCGCTTCGGGAGAGCGGG + Intergenic
1152544173 17:80992370-80992392 GGCAGCGACTCCGGGAGAGCCGG - Intronic
1152571620 17:81123652-81123674 GGGAGCTGCCCTGGGGGAGCTGG + Intronic
1152652068 17:81499431-81499453 GGGAGCAGCCCAGAGAGGGCAGG + Intergenic
1152700295 17:81815220-81815242 TGGAGCCGCTCAGGCAGAGCCGG + Intergenic
1152960304 18:75830-75852 GGGAGACGCTCCGGGACACCTGG - Intergenic
1154202388 18:12308401-12308423 GGGGGTCGCGCCGGGAGACCCGG - Intronic
1160504499 18:79419439-79419461 GGGAGCCCCCCTAGGAGGGCCGG + Intronic
1160504515 18:79419475-79419497 GGGAGCCCCCCTAGGAGGGCCGG + Intronic
1160504531 18:79419511-79419533 GGGAGCCCCCCTAGGAGGGCCGG + Intronic
1160566164 18:79787993-79788015 GAAGGCCGCCCCGGGAGAGCGGG + Intergenic
1160873277 19:1286444-1286466 GGGAGCCCCCCAGGGAGCTCCGG + Intronic
1160952763 19:1675535-1675557 GTGAGCCGGCCCGGGAGGACTGG + Intergenic
1160988721 19:1852001-1852023 GCGAGCAGCCCCGGGGGCGCAGG + Intergenic
1161139085 19:2637353-2637375 GGCAGCCTCTCCAGGAGAGCAGG - Intronic
1161222037 19:3122317-3122339 GAGCGCCGCCCCCGGGGAGCGGG + Exonic
1161374716 19:3933521-3933543 GGAGGCCGCCCCGGGGGAGGCGG - Exonic
1162327249 19:10006559-10006581 GGGAGCCTGCGCGGGAGAGCAGG - Intronic
1162929881 19:13952561-13952583 GGCGGCGGCCCCGGGGGAGCCGG + Exonic
1163202302 19:15777923-15777945 GGGAGCAGCCCCTGGATAGTGGG + Intergenic
1163294149 19:16401447-16401469 GGGAGGAGCCCTGGGAGAGAGGG + Intronic
1163632685 19:18425295-18425317 GTGAGCGGCCCCGGGAGGGCGGG - Intronic
1164594923 19:29526393-29526415 CGGAGCCGCACCGGGCAAGCCGG + Intergenic
1164989668 19:32674940-32674962 GGGAGCGGACTCCGGAGAGCAGG + Intronic
1166100032 19:40566223-40566245 AGGAGCCGCTCCTGCAGAGCCGG + Exonic
1166366600 19:42281207-42281229 GGGACCCGGGCCTGGAGAGCAGG + Intronic
1167032158 19:46969893-46969915 GGCAGCAGCACCAGGAGAGCTGG + Intronic
1167648604 19:50718476-50718498 CGGAGCCGGCCCGGGGGGGCTGG - Intronic
1202711997 1_KI270714v1_random:23970-23992 GGGAGCGGGCCAGGGAGAGCAGG + Intergenic
925029245 2:636642-636664 GGGAGCCGCGCCGGGGAAGAGGG + Intergenic
925202501 2:1979826-1979848 GTGAGCCGCCCCTGCAGGGCTGG - Intronic
927503181 2:23595822-23595844 AGCAGCCACCCTGGGAGAGCTGG - Intronic
927708503 2:25311382-25311404 GGGAGCCGCCCAGGGAGGGTGGG - Intronic
929452888 2:42048360-42048382 GGGAGCTGGCCCGGCAGATCCGG + Exonic
930705973 2:54505541-54505563 AGGAGCCTTCCTGGGAGAGCTGG - Intronic
932307814 2:70716323-70716345 GGGAATAGCCCCTGGAGAGCAGG - Intronic
932612459 2:73210005-73210027 TGCAGCGGCCCCGGGAGAGCTGG - Intronic
934978333 2:98821911-98821933 CGACGCCGGCCCGGGAGAGCGGG - Exonic
935622786 2:105144001-105144023 GGGCGGCGGCCAGGGAGAGCGGG - Intergenic
938139905 2:128787009-128787031 GCAAACCTCCCCGGGAGAGCAGG - Intergenic
938150010 2:128874533-128874555 GGGAGCTGGTGCGGGAGAGCTGG - Intergenic
943363101 2:186944831-186944853 GTGAGCAGCACCAGGAGAGCTGG - Intergenic
943645945 2:190408236-190408258 AGGAGCCGCAGCGGGAGAGAAGG + Intergenic
948207063 2:236168048-236168070 GGGAGCACCGCCGGGAGCGCCGG + Exonic
948230433 2:236345207-236345229 ATGAGCCGCACGGGGAGAGCAGG - Intronic
948716262 2:239865459-239865481 GGGAGCAGCCCCAGGTGAGCAGG - Intergenic
948836886 2:240630219-240630241 GGTAGATGCCCTGGGAGAGCTGG - Exonic
948868757 2:240787944-240787966 GAGAGCAGCCCCCAGAGAGCAGG - Intronic
1169088366 20:2840940-2840962 GGCAGACGCTCGGGGAGAGCCGG - Intronic
1169145667 20:3250651-3250673 CGGAGCCCGCCCGTGAGAGCGGG - Exonic
1171010330 20:21505973-21505995 GGGAGGCGGCCCGGGAGCGCGGG - Intergenic
1172996313 20:39072571-39072593 GGGAGCTACCCAGGGGGAGCGGG + Intergenic
1174471301 20:50763113-50763135 GGGAGACGCGCCAGGAGAGCAGG + Intergenic
1175862350 20:62157120-62157142 GGGAGCAGGCACAGGAGAGCCGG - Intronic
1177779982 21:25611758-25611780 GGGAGCAGCCCCTGGGAAGCAGG + Intergenic
1178876853 21:36420507-36420529 GTGAGGCGCCCTGGGAGAGCTGG + Intergenic
1178978235 21:37239066-37239088 TGCAGCCGCTCAGGGAGAGCAGG + Intronic
1179561751 21:42219798-42219820 GGAAGCTGCCCCCAGAGAGCCGG + Intronic
1180067107 21:45418044-45418066 GTGTGCCGCCCCCGGAGCGCTGG + Intronic
1180230591 21:46424686-46424708 GGGAGCAGGGCCGGGGGAGCAGG - Intronic
1182123633 22:27801554-27801576 GGGGGCCACGCCGGGCGAGCAGG + Intergenic
1182458218 22:30466102-30466124 GGGAGGATCCCTGGGAGAGCTGG + Intronic
1183184767 22:36285599-36285621 TGGAGCCACCACGGCAGAGCTGG - Intronic
1183735446 22:39642408-39642430 GGGAGCCCACCTGGCAGAGCTGG - Intronic
1184815007 22:46862577-46862599 GGGAGCCAGCCAGCGAGAGCGGG + Intronic
1185062592 22:48614868-48614890 TGGAGCCGGCCCTGGAGAGAAGG + Intronic
1185381151 22:50507984-50508006 TGGAGCTGCCGCGGGCGAGCGGG - Intergenic
949980818 3:9500782-9500804 GGGAGGCTCCCCGGGAGAGATGG + Exonic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
953518729 3:43621774-43621796 GGGAGGCGGCCCGGGAACGCAGG + Intronic
954411441 3:50372947-50372969 GGGAGGGGGCCCTGGAGAGCAGG + Intronic
955977041 3:64489509-64489531 CGGAGCGGCCCAGGGCGAGCCGG + Intergenic
959462504 3:106644107-106644129 GGGAGCGGGCGCGGGGGAGCAGG - Intergenic
960960488 3:123067300-123067322 GGGAGCTGCCCCGGGGCACCGGG + Intronic
961325100 3:126104995-126105017 TGGAGCAGCCCAGGGAGAGAGGG + Intronic
961818050 3:129561408-129561430 GAGAGAGGCCCCGGGAGGGCGGG - Intronic
965390269 3:168095677-168095699 GGGAGCCGCCGCGATAGGGCGGG - Exonic
966860848 3:184230234-184230256 GGGAGCCGCGGCGGGACTGCTGG + Intronic
966910552 3:184557240-184557262 GAGAGGTGCCCCGGCAGAGCTGG + Intronic
968078457 3:195830031-195830053 GGGAGCCGGCCCAGAGGAGCTGG - Intergenic
968486682 4:866319-866341 GGGAGGCGGCCATGGAGAGCTGG + Intronic
968487744 4:872058-872080 GGGATCCGCCGAGGGAGGGCAGG + Intronic
968545376 4:1195256-1195278 GGGACCCGCCCTGGGACCGCAGG - Intronic
972960605 4:44448242-44448264 GCGAGCTGCCCAGGGACAGCCGG - Exonic
974055271 4:56977481-56977503 GGGAGCCGCTCCTGGAGAGGAGG - Exonic
978503692 4:109434234-109434256 GGGGGCCGGCCTGGGAAAGCTGG + Intronic
983585821 4:169353525-169353547 GGGAGTTCCCCTGGGAGAGCAGG + Intergenic
984538923 4:181013036-181013058 GGAAGCCTCCCAGGGAGAGGAGG + Intergenic
985657394 5:1139330-1139352 GGGAGCAGCCCCTGGAAGGCAGG + Intergenic
985763557 5:1764555-1764577 AGGAGCCGCAGCCGGAGAGCTGG + Intergenic
985921567 5:2981333-2981355 GGGAGCCGCTCCCGGACTGCAGG + Intergenic
985931208 5:3059132-3059154 AGGAGCCAGCCCTGGAGAGCAGG + Intergenic
986321288 5:6633989-6634011 GGGGGACGCCCCGGGGGATCTGG - Intronic
992085517 5:73274898-73274920 GGGTGCCAGGCCGGGAGAGCAGG + Intergenic
992173857 5:74130437-74130459 GGGAGCAGACCCGGGAGGGTTGG - Intergenic
995462552 5:112419248-112419270 GGGAGCCGCCGGGGAAGCGCCGG + Exonic
998147951 5:139740816-139740838 GGGATCAGCCCTGGGAGTGCAGG + Intergenic
998957642 5:147453737-147453759 GGCAGCCGCCGCGGGAGCCCGGG - Intronic
1002101670 5:176860942-176860964 GGCAGGCGCCCAGGGAGGGCCGG + Intronic
1002428978 5:179192117-179192139 GGGAGAGGCCCTGGCAGAGCAGG + Intronic
1002534053 5:179866440-179866462 GGGAACAGCTCCAGGAGAGCTGG - Intronic
1002618311 5:180468962-180468984 GGGAGACACCCAGGCAGAGCTGG + Intergenic
1002898812 6:1393923-1393945 GGGAGCCGCCCCGGGAGAGCAGG + Intronic
1003874410 6:10423423-10423445 GGCAGCCGCCCTGGCACAGCGGG - Intergenic
1006361494 6:33589639-33589661 GGGATCTGCCTCGGGAGGGCGGG + Intergenic
1006806599 6:36793244-36793266 GGAAGCCGGCCCTGGAGGGCTGG + Intronic
1007665203 6:43509671-43509693 GGCAGCCGCGCAGTGAGAGCAGG + Exonic
1014019531 6:116571498-116571520 AGCTGCCGCGCCGGGAGAGCGGG - Exonic
1014098184 6:117482602-117482624 GGGAGACGCCCCCGCAGGGCTGG + Intronic
1018836904 6:167492120-167492142 GGCAGCCGCCCAAGGAGGGCTGG - Intergenic
1019088295 6:169502082-169502104 GGCAGCCGCCCCGGGGCTGCGGG + Intronic
1019616799 7:1966921-1966943 GGCAGCCTCTCCTGGAGAGCAGG - Intronic
1019634498 7:2068293-2068315 TGGAGCCGCCCAGAGCGAGCTGG + Intronic
1019681940 7:2355233-2355255 GGGCGAGGCCCCAGGAGAGCAGG + Exonic
1020210439 7:6154442-6154464 GGGAGCCCGCCAGAGAGAGCAGG + Exonic
1023810396 7:43906736-43906758 CGGAGCAGCCCGGGGACAGCTGG + Exonic
1023843611 7:44109475-44109497 GGGAGGGGCCCCGGGAGCCCAGG + Intronic
1023990076 7:45123621-45123643 GGGGTCAGCCCCGGGAGATCTGG + Intergenic
1025239089 7:57256685-57256707 TGGAGCTGTCCCGGGAGGGCTGG + Intergenic
1027151875 7:75739004-75739026 GGGAGCCGTCCCGTTAGCGCCGG - Intergenic
1028774046 7:94658145-94658167 GGGGGCGGCCCCGGGAGAGGCGG - Intronic
1029733326 7:102451848-102451870 GGGCTCCGCCCCGAGAGCGCAGG + Exonic
1030216019 7:107044683-107044705 GAGCGCGGCCCCGGGAGGGCTGG - Exonic
1031008450 7:116499731-116499753 GGGAGCCGCACCGCGCCAGCCGG + Exonic
1032025498 7:128438781-128438803 GGGAGCAGACCAGGGTGAGCTGG - Intergenic
1032083119 7:128869848-128869870 GGGCCCCGCACCGGGGGAGCAGG - Intronic
1033406157 7:141073162-141073184 CGGAGGCGTCGCGGGAGAGCCGG + Intergenic
1034174557 7:149090614-149090636 CGGAGCCGCCTCGGGTAAGCGGG - Exonic
1034416588 7:150968353-150968375 GGGTCCCTCCCCGGGAGAGTGGG + Intronic
1035552916 8:544313-544335 GGGCGCAGTCCCAGGAGAGCGGG - Intronic
1035632373 8:1117751-1117773 GGGGGCTCCCCCAGGAGAGCAGG + Intergenic
1036664700 8:10730762-10730784 GGGAGGCGGCCCGGGGCAGCCGG - Intronic
1037715570 8:21394623-21394645 GGCAGTCGCCCTGGGAGAGGTGG + Intergenic
1037787565 8:21911859-21911881 GAGAGCCCCCAGGGGAGAGCAGG + Intronic
1038029287 8:23622965-23622987 GGGAGCCGCGCGGGGATAGGAGG + Intergenic
1038540425 8:28386105-28386127 GCGGGCCGCGCCGGGAGGGCGGG - Intronic
1038828498 8:31032993-31033015 GGGAGCGGCCCCGGGGGCGGCGG - Exonic
1039412563 8:37367267-37367289 GGGAGCCTCAGCGAGAGAGCAGG - Intergenic
1042431056 8:68706858-68706880 GGCAGCCTCCCTGGGAGAGGAGG + Intronic
1048355692 8:133652403-133652425 TGGAGCAGGCCCAGGAGAGCAGG - Intergenic
1049415222 8:142491960-142491982 GGGAGCCGGCCAGGAGGAGCAGG + Intronic
1049440891 8:142609251-142609273 GCGAGGGGCCCTGGGAGAGCAGG - Intergenic
1049531970 8:143159516-143159538 CCGAGGCGCCGCGGGAGAGCCGG - Intronic
1049585125 8:143429427-143429449 CGGGGCGGCCCCGGGAGCGCGGG - Exonic
1049604735 8:143524058-143524080 GGGAGGCTGCCCGGGAGAGACGG - Intronic
1049607139 8:143534945-143534967 GGGGGCTGCCGCGGGAGGGCAGG - Intronic
1049617008 8:143579985-143580007 GTGAGCCGGCCGGGGAGAGGAGG - Intronic
1049747363 8:144268710-144268732 GGGAGCCACGCCGGGAGAGAGGG + Intronic
1050356973 9:4792846-4792868 GGGGGCCGCCCCGGTCGGGCGGG + Intronic
1053785851 9:41652311-41652333 GGCAGCGGCCCCGGGAGATGGGG - Intergenic
1054174567 9:61866274-61866296 GGCAGCGGCCCCGGGAGATGGGG - Intergenic
1054449424 9:65395322-65395344 GGCAGCGGCCCCGGGAGACGGGG - Intergenic
1054662971 9:67714517-67714539 GGCAGCGGCCCCGGGAGATGGGG + Intergenic
1055301479 9:74887486-74887508 GGGAAACACCCCGGGAGAGGAGG - Intronic
1057204555 9:93163446-93163468 GGGAGGCGCCCAGGGTCAGCTGG + Intergenic
1058900382 9:109437478-109437500 GAGAGCAGCCCCTTGAGAGCTGG + Intronic
1060216525 9:121741750-121741772 GGAAGCTGCCCCAGGATAGCTGG - Intronic
1060594538 9:124840362-124840384 GGGAGCCGCCCTGGCCGGGCAGG - Intergenic
1060918529 9:127405039-127405061 GGGAGCCGCCACAGCAGGGCCGG - Intronic
1061192966 9:129092983-129093005 GACAGCGGCCCCAGGAGAGCAGG - Intergenic
1061293597 9:129665841-129665863 GCGAGCGGCCCCGGGGGGGCCGG - Exonic
1062569994 9:137180601-137180623 GGGTGCCCCCCAGGCAGAGCAGG + Intronic
1062737796 9:138147884-138147906 GGGAGACGCTCCGGGACACCTGG + Intergenic
1186485587 X:9932288-9932310 CAGAGCTGCCCCGGGAGGGCCGG + Exonic
1186969221 X:14822158-14822180 GAGAGCTGCCCCCTGAGAGCTGG + Intergenic
1187403764 X:18984506-18984528 GGCAGCCGGCCGGGGAGAGAAGG - Exonic
1187698074 X:21940773-21940795 GGGAGCAGCCGCGGGAGACTGGG - Exonic
1189261201 X:39679945-39679967 GAGAGGAGCCCAGGGAGAGCTGG + Intergenic
1192533660 X:71910868-71910890 GTGTGCAGCCCCGGGGGAGCCGG + Intergenic
1193665351 X:84309643-84309665 AGGGGCAGCCCCGGGAGTGCTGG + Intergenic
1195343849 X:103928896-103928918 GGGAGCCTCCACGGTAGATCAGG - Intronic
1195363137 X:104104435-104104457 GGGAGCCTCCACGGTAGATCAGG + Exonic
1198048622 X:132927268-132927290 GGGAGCAGCCCAGGGAGACAGGG - Intronic
1199600771 X:149540088-149540110 GGGAGCAGCCGCGGGAGAAGCGG - Intergenic
1200180132 X:154144967-154144989 CGGAGCCGTCCTGGGAGAGAGGG + Intronic
1200185960 X:154183361-154183383 CGGAGCCGTCCTGGGAGAGAGGG + Intergenic
1200191612 X:154220499-154220521 CGGAGCCGTCCTGGGAGAGAGGG + Intronic
1200197367 X:154258303-154258325 CGGAGCCGTCCTGGGAGAGAGGG + Intronic