ID: 1002898834

View in Genome Browser
Species Human (GRCh38)
Location 6:1393994-1394016
Sequence CCTCGCGCTGCCAGATGCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002898825_1002898834 7 Left 1002898825 6:1393964-1393986 CCCCTCCAGCCTGGGGCTACCTC 0: 1
1: 0
2: 3
3: 35
4: 332
Right 1002898834 6:1393994-1394016 CCTCGCGCTGCCAGATGCTTCGG 0: 1
1: 0
2: 0
3: 5
4: 73
1002898830_1002898834 2 Left 1002898830 6:1393969-1393991 CCAGCCTGGGGCTACCTCAGGGA 0: 1
1: 0
2: 3
3: 29
4: 229
Right 1002898834 6:1393994-1394016 CCTCGCGCTGCCAGATGCTTCGG 0: 1
1: 0
2: 0
3: 5
4: 73
1002898819_1002898834 23 Left 1002898819 6:1393948-1393970 CCAGGCCTTCTCTGTCCCCCTCC 0: 1
1: 0
2: 9
3: 135
4: 1064
Right 1002898834 6:1393994-1394016 CCTCGCGCTGCCAGATGCTTCGG 0: 1
1: 0
2: 0
3: 5
4: 73
1002898826_1002898834 6 Left 1002898826 6:1393965-1393987 CCCTCCAGCCTGGGGCTACCTCA 0: 1
1: 0
2: 1
3: 29
4: 284
Right 1002898834 6:1393994-1394016 CCTCGCGCTGCCAGATGCTTCGG 0: 1
1: 0
2: 0
3: 5
4: 73
1002898824_1002898834 8 Left 1002898824 6:1393963-1393985 CCCCCTCCAGCCTGGGGCTACCT 0: 1
1: 0
2: 5
3: 42
4: 392
Right 1002898834 6:1393994-1394016 CCTCGCGCTGCCAGATGCTTCGG 0: 1
1: 0
2: 0
3: 5
4: 73
1002898831_1002898834 -2 Left 1002898831 6:1393973-1393995 CCTGGGGCTACCTCAGGGACTCC 0: 1
1: 0
2: 0
3: 15
4: 195
Right 1002898834 6:1393994-1394016 CCTCGCGCTGCCAGATGCTTCGG 0: 1
1: 0
2: 0
3: 5
4: 73
1002898827_1002898834 5 Left 1002898827 6:1393966-1393988 CCTCCAGCCTGGGGCTACCTCAG 0: 1
1: 0
2: 1
3: 45
4: 675
Right 1002898834 6:1393994-1394016 CCTCGCGCTGCCAGATGCTTCGG 0: 1
1: 0
2: 0
3: 5
4: 73
1002898820_1002898834 18 Left 1002898820 6:1393953-1393975 CCTTCTCTGTCCCCCTCCAGCCT 0: 1
1: 0
2: 12
3: 156
4: 1223
Right 1002898834 6:1393994-1394016 CCTCGCGCTGCCAGATGCTTCGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002898834 Original CRISPR CCTCGCGCTGCCAGATGCTT CGG Intronic
901532092 1:9859992-9860014 CCTCCCACACCCAGATGCTTTGG - Intronic
906281727 1:44559227-44559249 CCTCAGCCTTCCAGATGCTTGGG + Intronic
907059873 1:51410633-51410655 CCTCCTGCTGACAGATACTTCGG - Intronic
911052148 1:93680788-93680810 CGCCGCCTTGCCAGATGCTTCGG + Intronic
1064154357 10:12891384-12891406 TCTCCAGTTGCCAGATGCTTGGG - Intergenic
1065881840 10:30043795-30043817 CCCCGGGCTGCCAGATGCCTTGG - Intronic
1068247706 10:54394332-54394354 TCTCAAGCTGGCAGATGCTTAGG - Intronic
1069976664 10:72218992-72219014 CCTCACTCTGGCAGTTGCTTGGG + Intronic
1070934616 10:80283643-80283665 CTTGGCGCTGCCAAAGGCTTTGG - Intronic
1071185477 10:83039215-83039237 CCTCTTGCTGCAAGGTGCTTAGG + Intergenic
1079133051 11:17760698-17760720 GCACGCGCTGCCTGCTGCTTAGG + Intronic
1081794414 11:45809758-45809780 CCCCGTGTTGCCAGATGCTGTGG + Intronic
1082855852 11:57805996-57806018 CCACATGCTGCCAGTTGCTTTGG + Exonic
1091868655 12:3867948-3867970 GCTGGCGCTGTCAGATGTTTAGG - Intronic
1096916499 12:55039117-55039139 CCTGGAGCTTCCAGAGGCTTAGG - Intergenic
1101397477 12:104361125-104361147 CATCTCTCTGCCAGATGCTCGGG + Intergenic
1103863257 12:124030748-124030770 CCTCGGGCTGCAAGATGCCTGGG + Intronic
1104164872 12:126217991-126218013 ACTCTGCCTGCCAGATGCTTTGG - Intergenic
1109484100 13:62996401-62996423 CCTAGGGCTGCCTGATGATTGGG + Intergenic
1119541079 14:75438642-75438664 CCTAGCTCTGGCAGCTGCTTGGG - Intronic
1121180628 14:91926072-91926094 CCTCACTCTGCCAGATGCTGTGG + Intronic
1138029978 16:53552215-53552237 CTTTGCCCTGCCACATGCTTGGG - Intergenic
1143756204 17:9069620-9069642 CCTCGCCCTGCCTGCTTCTTGGG + Intronic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1145077317 17:19867130-19867152 CGGAGCGCTGCCAGAGGCTTGGG + Intronic
1146079850 17:29769465-29769487 CCTCTTGCTACCAGATCCTTTGG + Intronic
1147140012 17:38455508-38455530 CCTGGAGCTGCCAGCTGCCTGGG - Intronic
1151530022 17:74698225-74698247 CCTGGCACTGCCAGCTGCTGAGG + Intronic
1152820688 17:82436200-82436222 GCTCGCTCTGCCTGAGGCTTTGG + Intronic
1152890768 17:82880580-82880602 CCTCCTCCTGCCAGATCCTTGGG - Intronic
1153156337 18:2153655-2153677 CCTAGGGCTGCCAGTTGCATTGG + Intergenic
1160749283 19:726390-726412 CCTCGCTCTGCCTGATGGGTCGG + Intronic
1161589432 19:5122449-5122471 CCTCTGCCTGCCACATGCTTAGG + Intronic
1163414341 19:17176877-17176899 CCTGGTGCTGGCACATGCTTGGG - Intronic
1163774796 19:19211864-19211886 CCTCGCGCAGCCAGAGGCCTCGG + Intergenic
1166300121 19:41908377-41908399 CCTGGCGCTGCCAGGGGCTGGGG - Intronic
927607145 2:24495754-24495776 CCTAGCTCTTCCAGATACTTAGG + Intronic
927894911 2:26775482-26775504 CCTCCAGCTTCCAGATGCTGCGG + Exonic
928611069 2:32993070-32993092 CCCCCCGCTGCCAGCTGCTGTGG - Intronic
929093344 2:38241023-38241045 CCTCCCTCTGCCAGCTACTTAGG - Intergenic
934737616 2:96697930-96697952 CCGCTGACTGCCAGATGCTTTGG + Intergenic
935121185 2:100184995-100185017 CCTGGAGCTGGCAGATGCTGTGG - Intergenic
948073711 2:235148781-235148803 CTTCAGGCTGTCAGATGCTTTGG - Intergenic
949021902 2:241745518-241745540 TCTTGAGCTGCCAGAAGCTTGGG + Intronic
1170914498 20:20609655-20609677 TCTCACACTGGCAGATGCTTGGG - Intronic
1175545526 20:59775504-59775526 CCTCCCGCTTCCTGCTGCTTTGG + Intronic
1179209497 21:39313392-39313414 CCTGGCGCTCCCGGCTGCTTCGG - Intronic
1182354015 22:29714043-29714065 CCTCTCGCTGCCACAGGCTCAGG + Intergenic
1183541081 22:38429767-38429789 CCTGGCCCTGCCAGCTGCTGGGG - Intronic
1184575968 22:45366272-45366294 CCTCGAGCTCCCAGATTGTTAGG + Intronic
949938349 3:9134893-9134915 CCTGGCCCTGCCACATGCTCAGG + Intronic
956245500 3:67177596-67177618 CCTGGCCCTGCCAGATCTTTGGG + Intergenic
960720690 3:120622343-120622365 CCTGCCTCTGCCAGCTGCTTAGG + Intergenic
960864631 3:122186578-122186600 CCTGGAGCTTACAGATGCTTTGG + Intronic
967743489 3:193029071-193029093 CCTCCCACTGCCATATGATTTGG - Intergenic
969171664 4:5368851-5368873 CCTTGCCATGCCAGATGCTGGGG + Intronic
969512975 4:7630114-7630136 CCTCACTTTGCCAGATGCCTTGG - Intronic
972327858 4:38034873-38034895 CCTCCTGCTCCCAAATGCTTTGG - Intronic
981657183 4:147125013-147125035 CCACCCTATGCCAGATGCTTGGG - Intergenic
997296642 5:132772851-132772873 GCTTGGGCTGCCTGATGCTTGGG - Intronic
1000851632 5:166347352-166347374 CCTCCCCCAGCCAGAAGCTTTGG - Intergenic
1002898834 6:1393994-1394016 CCTCGCGCTGCCAGATGCTTCGG + Intronic
1005343385 6:24864671-24864693 CCTCTCTATGTCAGATGCTTGGG + Intronic
1006127030 6:31845566-31845588 CCTCTACCTGCCAGTTGCTTAGG + Intergenic
1007321992 6:41034173-41034195 CCTCTCCCTGCCAGGTGCTGTGG - Exonic
1030614780 7:111728356-111728378 GATCGCGCTGCCAGAGGCTTGGG + Exonic
1031014707 7:116560494-116560516 CCTCCCCCTGCCAGGAGCTTTGG + Exonic
1035047010 7:155974277-155974299 CCTGGGGCGGCCACATGCTTAGG - Intergenic
1037821749 8:22138526-22138548 CCTCGCGCTCCCTGAAGGTTCGG - Exonic
1045860810 8:106813250-106813272 CCTCAAGCTGCCACATGCCTAGG - Intergenic
1047644562 8:126856300-126856322 CCTTGAGCTGCCACATACTTAGG + Intergenic
1048104017 8:131387804-131387826 CCTGGAGCTGCCATAGGCTTTGG - Intergenic
1049324180 8:142013385-142013407 CCACGTGGTGCCAGATGCTCTGG + Intergenic
1053285337 9:36846623-36846645 CCTCCCTCCCCCAGATGCTTTGG - Intronic
1056136594 9:83635378-83635400 TCTCGCGCCACCAGATTCTTTGG - Intronic
1057724382 9:97557697-97557719 CCTCCTGCTGCCAGCTGCTCGGG - Intronic
1060743336 9:126113854-126113876 GCTCTCACTGCCAGATGCTGGGG + Intergenic
1062423184 9:136493850-136493872 CCTCGCTCAGCCAGTTCCTTAGG + Intergenic
1185730459 X:2457279-2457301 CATCCCGCTGCCACATTCTTAGG - Intronic