ID: 1002900334

View in Genome Browser
Species Human (GRCh38)
Location 6:1405436-1405458
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002900334_1002900337 -10 Left 1002900334 6:1405436-1405458 CCTATAGTTATGGACTCCACAAG No data
Right 1002900337 6:1405449-1405471 ACTCCACAAGTCCCTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002900334 Original CRISPR CTTGTGGAGTCCATAACTAT AGG (reversed) Intergenic
No off target data available for this crispr