ID: 1002900337

View in Genome Browser
Species Human (GRCh38)
Location 6:1405449-1405471
Sequence ACTCCACAAGTCCCTGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002900325_1002900337 26 Left 1002900325 6:1405400-1405422 CCCCAGCGGGACTGCATTCTTTT No data
Right 1002900337 6:1405449-1405471 ACTCCACAAGTCCCTGGGAGAGG No data
1002900334_1002900337 -10 Left 1002900334 6:1405436-1405458 CCTATAGTTATGGACTCCACAAG No data
Right 1002900337 6:1405449-1405471 ACTCCACAAGTCCCTGGGAGAGG No data
1002900326_1002900337 25 Left 1002900326 6:1405401-1405423 CCCAGCGGGACTGCATTCTTTTG No data
Right 1002900337 6:1405449-1405471 ACTCCACAAGTCCCTGGGAGAGG No data
1002900324_1002900337 27 Left 1002900324 6:1405399-1405421 CCCCCAGCGGGACTGCATTCTTT No data
Right 1002900337 6:1405449-1405471 ACTCCACAAGTCCCTGGGAGAGG No data
1002900327_1002900337 24 Left 1002900327 6:1405402-1405424 CCAGCGGGACTGCATTCTTTTGG No data
Right 1002900337 6:1405449-1405471 ACTCCACAAGTCCCTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002900337 Original CRISPR ACTCCACAAGTCCCTGGGAG AGG Intergenic
No off target data available for this crispr