ID: 1002900804

View in Genome Browser
Species Human (GRCh38)
Location 6:1408202-1408224
Sequence GGTCCCCGAAGGACAGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002900804_1002900808 -7 Left 1002900804 6:1408202-1408224 CCAAAGGCTGTCCTTCGGGGACC No data
Right 1002900808 6:1408218-1408240 GGGGACCTGGGCGCCTGATGTGG No data
1002900804_1002900810 -3 Left 1002900804 6:1408202-1408224 CCAAAGGCTGTCCTTCGGGGACC No data
Right 1002900810 6:1408222-1408244 ACCTGGGCGCCTGATGTGGGTGG No data
1002900804_1002900813 26 Left 1002900804 6:1408202-1408224 CCAAAGGCTGTCCTTCGGGGACC No data
Right 1002900813 6:1408251-1408273 GATTTACAATAGCACTCACCTGG No data
1002900804_1002900814 27 Left 1002900804 6:1408202-1408224 CCAAAGGCTGTCCTTCGGGGACC No data
Right 1002900814 6:1408252-1408274 ATTTACAATAGCACTCACCTGGG No data
1002900804_1002900809 -6 Left 1002900804 6:1408202-1408224 CCAAAGGCTGTCCTTCGGGGACC No data
Right 1002900809 6:1408219-1408241 GGGACCTGGGCGCCTGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002900804 Original CRISPR GGTCCCCGAAGGACAGCCTT TGG (reversed) Intergenic
No off target data available for this crispr