ID: 1002902088

View in Genome Browser
Species Human (GRCh38)
Location 6:1417660-1417682
Sequence ATGCAGTTGGAGCTGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002902088_1002902093 12 Left 1002902088 6:1417660-1417682 CCATGTCCCAGCTCCAACTGCAT No data
Right 1002902093 6:1417695-1417717 GTGCCTCACACAGGTGAGTGTGG No data
1002902088_1002902092 3 Left 1002902088 6:1417660-1417682 CCATGTCCCAGCTCCAACTGCAT No data
Right 1002902092 6:1417686-1417708 AGACGTGATGTGCCTCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002902088 Original CRISPR ATGCAGTTGGAGCTGGGACA TGG (reversed) Intergenic
No off target data available for this crispr