ID: 1002909881

View in Genome Browser
Species Human (GRCh38)
Location 6:1481686-1481708
Sequence CAGGGAATGCAGAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002909881_1002909887 -3 Left 1002909881 6:1481686-1481708 CCAGCCTCCCTCTGCATTCCCTG No data
Right 1002909887 6:1481706-1481728 CTGACCTGATGCTAATCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002909881 Original CRISPR CAGGGAATGCAGAGGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr