ID: 1002912504

View in Genome Browser
Species Human (GRCh38)
Location 6:1501139-1501161
Sequence GTGGAGTGAAAGAGGTGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002912492_1002912504 16 Left 1002912492 6:1501100-1501122 CCTCCATGGAGAAGGCACATGTC No data
Right 1002912504 6:1501139-1501161 GTGGAGTGAAAGAGGTGAGGGGG No data
1002912494_1002912504 13 Left 1002912494 6:1501103-1501125 CCATGGAGAAGGCACATGTCGGC No data
Right 1002912504 6:1501139-1501161 GTGGAGTGAAAGAGGTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002912504 Original CRISPR GTGGAGTGAAAGAGGTGAGG GGG Intergenic
No off target data available for this crispr