ID: 1002913589

View in Genome Browser
Species Human (GRCh38)
Location 6:1510417-1510439
Sequence GTGCATATCCTGTCTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002913589_1002913591 -5 Left 1002913589 6:1510417-1510439 CCTGGGGAAGACAGGATATGCAC No data
Right 1002913591 6:1510435-1510457 TGCACATGGCCCTCCCCCACTGG No data
1002913589_1002913594 6 Left 1002913589 6:1510417-1510439 CCTGGGGAAGACAGGATATGCAC No data
Right 1002913594 6:1510446-1510468 CTCCCCCACTGGTGTGAAGCTGG No data
1002913589_1002913601 19 Left 1002913589 6:1510417-1510439 CCTGGGGAAGACAGGATATGCAC No data
Right 1002913601 6:1510459-1510481 GTGAAGCTGGAGTTTGGACTGGG No data
1002913589_1002913603 28 Left 1002913589 6:1510417-1510439 CCTGGGGAAGACAGGATATGCAC No data
Right 1002913603 6:1510468-1510490 GAGTTTGGACTGGGAGCTGAGGG No data
1002913589_1002913600 18 Left 1002913589 6:1510417-1510439 CCTGGGGAAGACAGGATATGCAC No data
Right 1002913600 6:1510458-1510480 TGTGAAGCTGGAGTTTGGACTGG No data
1002913589_1002913599 13 Left 1002913589 6:1510417-1510439 CCTGGGGAAGACAGGATATGCAC No data
Right 1002913599 6:1510453-1510475 ACTGGTGTGAAGCTGGAGTTTGG No data
1002913589_1002913602 27 Left 1002913589 6:1510417-1510439 CCTGGGGAAGACAGGATATGCAC No data
Right 1002913602 6:1510467-1510489 GGAGTTTGGACTGGGAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002913589 Original CRISPR GTGCATATCCTGTCTTCCCC AGG (reversed) Intergenic
No off target data available for this crispr