ID: 1002916886

View in Genome Browser
Species Human (GRCh38)
Location 6:1536664-1536686
Sequence CTGAGATGGGGGAAGTTAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002916886_1002916895 12 Left 1002916886 6:1536664-1536686 CCCGTTAACTTCCCCCATCTCAG No data
Right 1002916895 6:1536699-1536721 CCTCACAGCAGCCGACAGCCGGG No data
1002916886_1002916893 11 Left 1002916886 6:1536664-1536686 CCCGTTAACTTCCCCCATCTCAG No data
Right 1002916893 6:1536698-1536720 ACCTCACAGCAGCCGACAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002916886 Original CRISPR CTGAGATGGGGGAAGTTAAC GGG (reversed) Intergenic
No off target data available for this crispr