ID: 1002921418

View in Genome Browser
Species Human (GRCh38)
Location 6:1575851-1575873
Sequence AGTTCTCTCTCCAAAACCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002921415_1002921418 -9 Left 1002921415 6:1575837-1575859 CCAGTAACACCAGAAGTTCTCTC No data
Right 1002921418 6:1575851-1575873 AGTTCTCTCTCCAAAACCGGCGG No data
1002921414_1002921418 13 Left 1002921414 6:1575815-1575837 CCTGTTCACAAAGAAAAGGATTC No data
Right 1002921418 6:1575851-1575873 AGTTCTCTCTCCAAAACCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002921418 Original CRISPR AGTTCTCTCTCCAAAACCGG CGG Intergenic
No off target data available for this crispr