ID: 1002921714

View in Genome Browser
Species Human (GRCh38)
Location 6:1577554-1577576
Sequence CCTACCTGGCCCAGGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002921699_1002921714 16 Left 1002921699 6:1577515-1577537 CCTGCCAGCCCTGCCTGCCCCTG No data
Right 1002921714 6:1577554-1577576 CCTACCTGGCCCAGGCTGGAAGG No data
1002921702_1002921714 7 Left 1002921702 6:1577524-1577546 CCTGCCTGCCCCTGCCATGCCTG No data
Right 1002921714 6:1577554-1577576 CCTACCTGGCCCAGGCTGGAAGG No data
1002921700_1002921714 12 Left 1002921700 6:1577519-1577541 CCAGCCCTGCCTGCCCCTGCCAT No data
Right 1002921714 6:1577554-1577576 CCTACCTGGCCCAGGCTGGAAGG No data
1002921704_1002921714 -1 Left 1002921704 6:1577532-1577554 CCCCTGCCATGCCTGCCACACTC No data
Right 1002921714 6:1577554-1577576 CCTACCTGGCCCAGGCTGGAAGG No data
1002921701_1002921714 8 Left 1002921701 6:1577523-1577545 CCCTGCCTGCCCCTGCCATGCCT No data
Right 1002921714 6:1577554-1577576 CCTACCTGGCCCAGGCTGGAAGG No data
1002921706_1002921714 -3 Left 1002921706 6:1577534-1577556 CCTGCCATGCCTGCCACACTCCT No data
Right 1002921714 6:1577554-1577576 CCTACCTGGCCCAGGCTGGAAGG No data
1002921707_1002921714 -7 Left 1002921707 6:1577538-1577560 CCATGCCTGCCACACTCCTACCT No data
Right 1002921714 6:1577554-1577576 CCTACCTGGCCCAGGCTGGAAGG No data
1002921705_1002921714 -2 Left 1002921705 6:1577533-1577555 CCCTGCCATGCCTGCCACACTCC No data
Right 1002921714 6:1577554-1577576 CCTACCTGGCCCAGGCTGGAAGG No data
1002921703_1002921714 3 Left 1002921703 6:1577528-1577550 CCTGCCCCTGCCATGCCTGCCAC No data
Right 1002921714 6:1577554-1577576 CCTACCTGGCCCAGGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002921714 Original CRISPR CCTACCTGGCCCAGGCTGGA AGG Intergenic
No off target data available for this crispr