ID: 1002925188

View in Genome Browser
Species Human (GRCh38)
Location 6:1601840-1601862
Sequence GAAGACCCTGGGCACCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002925178_1002925188 24 Left 1002925178 6:1601793-1601815 CCGGCAGGACTGGGCTTCCCCGG No data
Right 1002925188 6:1601840-1601862 GAAGACCCTGGGCACCCCTGTGG No data
1002925182_1002925188 7 Left 1002925182 6:1601810-1601832 CCCCGGCTCTTCGAGGGAAGACC No data
Right 1002925188 6:1601840-1601862 GAAGACCCTGGGCACCCCTGTGG No data
1002925177_1002925188 29 Left 1002925177 6:1601788-1601810 CCACTCCGGCAGGACTGGGCTTC No data
Right 1002925188 6:1601840-1601862 GAAGACCCTGGGCACCCCTGTGG No data
1002925176_1002925188 30 Left 1002925176 6:1601787-1601809 CCCACTCCGGCAGGACTGGGCTT No data
Right 1002925188 6:1601840-1601862 GAAGACCCTGGGCACCCCTGTGG No data
1002925183_1002925188 6 Left 1002925183 6:1601811-1601833 CCCGGCTCTTCGAGGGAAGACCG No data
Right 1002925188 6:1601840-1601862 GAAGACCCTGGGCACCCCTGTGG No data
1002925184_1002925188 5 Left 1002925184 6:1601812-1601834 CCGGCTCTTCGAGGGAAGACCGC No data
Right 1002925188 6:1601840-1601862 GAAGACCCTGGGCACCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002925188 Original CRISPR GAAGACCCTGGGCACCCCTG TGG Intergenic
No off target data available for this crispr