ID: 1002926471

View in Genome Browser
Species Human (GRCh38)
Location 6:1608602-1608624
Sequence AGAATCGCCGTGCCGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002926465_1002926471 -4 Left 1002926465 6:1608583-1608605 CCTCAAGTCGCTAAAATGCAGAA No data
Right 1002926471 6:1608602-1608624 AGAATCGCCGTGCCGGGGGAGGG No data
1002926464_1002926471 10 Left 1002926464 6:1608569-1608591 CCGGGAGGGTCTCTCCTCAAGTC No data
Right 1002926471 6:1608602-1608624 AGAATCGCCGTGCCGGGGGAGGG No data
1002926463_1002926471 13 Left 1002926463 6:1608566-1608588 CCTCCGGGAGGGTCTCTCCTCAA No data
Right 1002926471 6:1608602-1608624 AGAATCGCCGTGCCGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002926471 Original CRISPR AGAATCGCCGTGCCGGGGGA GGG Intergenic