ID: 1002926695

View in Genome Browser
Species Human (GRCh38)
Location 6:1609453-1609475
Sequence AGCCCCGCCGACGCCAGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002926695_1002926705 27 Left 1002926695 6:1609453-1609475 CCAGCGCTGGCGTCGGCGGGGCT No data
Right 1002926705 6:1609503-1609525 GAGGCGGGGCGGAGACGCCAGGG No data
1002926695_1002926698 8 Left 1002926695 6:1609453-1609475 CCAGCGCTGGCGTCGGCGGGGCT No data
Right 1002926698 6:1609484-1609506 AATGAGAGCGAGCCAGCACGAGG No data
1002926695_1002926704 26 Left 1002926695 6:1609453-1609475 CCAGCGCTGGCGTCGGCGGGGCT No data
Right 1002926704 6:1609502-1609524 CGAGGCGGGGCGGAGACGCCAGG No data
1002926695_1002926699 11 Left 1002926695 6:1609453-1609475 CCAGCGCTGGCGTCGGCGGGGCT No data
Right 1002926699 6:1609487-1609509 GAGAGCGAGCCAGCACGAGGCGG No data
1002926695_1002926702 16 Left 1002926695 6:1609453-1609475 CCAGCGCTGGCGTCGGCGGGGCT No data
Right 1002926702 6:1609492-1609514 CGAGCCAGCACGAGGCGGGGCGG No data
1002926695_1002926700 12 Left 1002926695 6:1609453-1609475 CCAGCGCTGGCGTCGGCGGGGCT No data
Right 1002926700 6:1609488-1609510 AGAGCGAGCCAGCACGAGGCGGG No data
1002926695_1002926701 13 Left 1002926695 6:1609453-1609475 CCAGCGCTGGCGTCGGCGGGGCT No data
Right 1002926701 6:1609489-1609511 GAGCGAGCCAGCACGAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002926695 Original CRISPR AGCCCCGCCGACGCCAGCGC TGG (reversed) Intergenic