ID: 1002926699

View in Genome Browser
Species Human (GRCh38)
Location 6:1609487-1609509
Sequence GAGAGCGAGCCAGCACGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002926692_1002926699 13 Left 1002926692 6:1609451-1609473 CCCCAGCGCTGGCGTCGGCGGGG No data
Right 1002926699 6:1609487-1609509 GAGAGCGAGCCAGCACGAGGCGG No data
1002926694_1002926699 12 Left 1002926694 6:1609452-1609474 CCCAGCGCTGGCGTCGGCGGGGC No data
Right 1002926699 6:1609487-1609509 GAGAGCGAGCCAGCACGAGGCGG No data
1002926695_1002926699 11 Left 1002926695 6:1609453-1609475 CCAGCGCTGGCGTCGGCGGGGCT No data
Right 1002926699 6:1609487-1609509 GAGAGCGAGCCAGCACGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002926699 Original CRISPR GAGAGCGAGCCAGCACGAGG CGG Intergenic