ID: 1002926701

View in Genome Browser
Species Human (GRCh38)
Location 6:1609489-1609511
Sequence GAGCGAGCCAGCACGAGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002926692_1002926701 15 Left 1002926692 6:1609451-1609473 CCCCAGCGCTGGCGTCGGCGGGG No data
Right 1002926701 6:1609489-1609511 GAGCGAGCCAGCACGAGGCGGGG No data
1002926695_1002926701 13 Left 1002926695 6:1609453-1609475 CCAGCGCTGGCGTCGGCGGGGCT No data
Right 1002926701 6:1609489-1609511 GAGCGAGCCAGCACGAGGCGGGG No data
1002926694_1002926701 14 Left 1002926694 6:1609452-1609474 CCCAGCGCTGGCGTCGGCGGGGC No data
Right 1002926701 6:1609489-1609511 GAGCGAGCCAGCACGAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002926701 Original CRISPR GAGCGAGCCAGCACGAGGCG GGG Intergenic