ID: 1002926705

View in Genome Browser
Species Human (GRCh38)
Location 6:1609503-1609525
Sequence GAGGCGGGGCGGAGACGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002926692_1002926705 29 Left 1002926692 6:1609451-1609473 CCCCAGCGCTGGCGTCGGCGGGG No data
Right 1002926705 6:1609503-1609525 GAGGCGGGGCGGAGACGCCAGGG No data
1002926695_1002926705 27 Left 1002926695 6:1609453-1609475 CCAGCGCTGGCGTCGGCGGGGCT No data
Right 1002926705 6:1609503-1609525 GAGGCGGGGCGGAGACGCCAGGG No data
1002926694_1002926705 28 Left 1002926694 6:1609452-1609474 CCCAGCGCTGGCGTCGGCGGGGC No data
Right 1002926705 6:1609503-1609525 GAGGCGGGGCGGAGACGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002926705 Original CRISPR GAGGCGGGGCGGAGACGCCA GGG Intergenic