ID: 1002926705 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:1609503-1609525 |
Sequence | GAGGCGGGGCGGAGACGCCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1002926692_1002926705 | 29 | Left | 1002926692 | 6:1609451-1609473 | CCCCAGCGCTGGCGTCGGCGGGG | No data | ||
Right | 1002926705 | 6:1609503-1609525 | GAGGCGGGGCGGAGACGCCAGGG | No data | ||||
1002926695_1002926705 | 27 | Left | 1002926695 | 6:1609453-1609475 | CCAGCGCTGGCGTCGGCGGGGCT | No data | ||
Right | 1002926705 | 6:1609503-1609525 | GAGGCGGGGCGGAGACGCCAGGG | No data | ||||
1002926694_1002926705 | 28 | Left | 1002926694 | 6:1609452-1609474 | CCCAGCGCTGGCGTCGGCGGGGC | No data | ||
Right | 1002926705 | 6:1609503-1609525 | GAGGCGGGGCGGAGACGCCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1002926705 | Original CRISPR | GAGGCGGGGCGGAGACGCCA GGG | Intergenic | ||