ID: 1002929538

View in Genome Browser
Species Human (GRCh38)
Location 6:1624015-1624037
Sequence GCGGCCCCGCTCTTGCGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 93}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002929529_1002929538 2 Left 1002929529 6:1623990-1624012 CCCGGCTGCTACAAACCTCGGCG 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1002929538 6:1624015-1624037 GCGGCCCCGCTCTTGCGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 93
1002929527_1002929538 17 Left 1002929527 6:1623975-1623997 CCTGGAGGGTCACATCCCGGCTG 0: 1
1: 0
2: 0
3: 2
4: 107
Right 1002929538 6:1624015-1624037 GCGGCCCCGCTCTTGCGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 93
1002929526_1002929538 18 Left 1002929526 6:1623974-1623996 CCCTGGAGGGTCACATCCCGGCT 0: 1
1: 0
2: 1
3: 12
4: 97
Right 1002929538 6:1624015-1624037 GCGGCCCCGCTCTTGCGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 93
1002929523_1002929538 24 Left 1002929523 6:1623968-1623990 CCCAAACCCTGGAGGGTCACATC 0: 1
1: 0
2: 0
3: 5
4: 128
Right 1002929538 6:1624015-1624037 GCGGCCCCGCTCTTGCGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 93
1002929524_1002929538 23 Left 1002929524 6:1623969-1623991 CCAAACCCTGGAGGGTCACATCC 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1002929538 6:1624015-1624037 GCGGCCCCGCTCTTGCGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 93
1002929530_1002929538 1 Left 1002929530 6:1623991-1624013 CCGGCTGCTACAAACCTCGGCGG 0: 1
1: 0
2: 0
3: 0
4: 50
Right 1002929538 6:1624015-1624037 GCGGCCCCGCTCTTGCGGCCGGG 0: 1
1: 0
2: 0
3: 9
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002929538 Original CRISPR GCGGCCCCGCTCTTGCGGCC GGG Exonic